Explain about the endocrine system, Biology

Assignment Help:

Why is the endocrine system considered one of the integrative systems of the body? What is the other physiological system that also has this function?

The endocrine system is said to have integrative character as the hormones formed by the endocrine glands are substances that act at a distance and lots of them act in dissimilar organs of the body. So the endocrine glands receive information from some regions of the body and they can make effects in other regions providing functional integration for the body.

 


Related Discussions:- Explain about the endocrine system

State the term - antecedent and consequence control, Antecedent and consequ...

Antecedent and consequence control Therapy and consultation cannot be effective unless the behaviours to be changed are understood within a particular context. The process of u

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Systems of classification plants, Q. Can you show the Systems of classifica...

Q. Can you show the Systems of classification plants? The development of angiosperm classification has been one of the most fascinating subject. A study of sequential events le

Carbon dioxide for photosynthesis, Aim: To prove that Carbon dioxide is ess...

Aim: To prove that Carbon dioxide is essential for photosynthesis. Apparatus: A potted healthy plant with long and narrow leaves, a wide mouthed glass bottle, split cork. Chemicals

Explain the term- latent squint, Explain the term- Latent Squint (Anisophor...

Explain the term- Latent Squint (Anisophoria or Heterophoria) This eye condition occurs when the balance of extra-ocular muscles is altered. There is a tendency of the eye to

Agro industrial-mineral biofortification of plants, Mineral biofortificatio...

Mineral biofortification of plants One sustainable agricultural approach to reducing the mineral deficiencies in livestock animals is to enrich major staple food crops (rice,

What is digestion, What  is digestion? The  ingested food material  is...

What  is digestion? The  ingested food material  is  broken down  into smaller constituents which  are assimilable  by  the  blood.  The  process  through which  the major nutr

Chloroplasts, Chloroplasts are disk-like organelles with the double membra...

Chloroplasts are disk-like organelles with the double membrane found in the eukaryotic plant cells; contain thylakoids and are the site of photosynthesis. ATP is generated during

Define hormonal responses to injury, Define Hormonal Responses to Injury? ...

Define Hormonal Responses to Injury?  A number of hormonal changes take place in patients following injury. There is a marked rise in the counter regulatory hormones, viz., glu

Cytosol of prokaryotes, The  citric  acid  cycle  functions  in  the  mitoc...

The  citric  acid  cycle  functions  in  the  mitochondria   of  eukaryotes  and  in  the cytosol of prokaryotes. The Succinate dehydrogenase, the only membrane-bound enzyme   in t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd