Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Why is the endocrine system considered one of the integrative systems of the body? What is the other physiological system that also has this function?
The endocrine system is said to have integrative character as the hormones formed by the endocrine glands are substances that act at a distance and lots of them act in dissimilar organs of the body. So the endocrine glands receive information from some regions of the body and they can make effects in other regions providing functional integration for the body.
Antecedent and consequence control Therapy and consultation cannot be effective unless the behaviours to be changed are understood within a particular context. The process of u
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Can you show the Systems of classification plants? The development of angiosperm classification has been one of the most fascinating subject. A study of sequential events le
Aim: To prove that Carbon dioxide is essential for photosynthesis. Apparatus: A potted healthy plant with long and narrow leaves, a wide mouthed glass bottle, split cork. Chemicals
Explain the term- Latent Squint (Anisophoria or Heterophoria) This eye condition occurs when the balance of extra-ocular muscles is altered. There is a tendency of the eye to
Mineral biofortification of plants One sustainable agricultural approach to reducing the mineral deficiencies in livestock animals is to enrich major staple food crops (rice,
What is digestion? The ingested food material is broken down into smaller constituents which are assimilable by the blood. The process through which the major nutr
Chloroplasts are disk-like organelles with the double membrane found in the eukaryotic plant cells; contain thylakoids and are the site of photosynthesis. ATP is generated during
Define Hormonal Responses to Injury? A number of hormonal changes take place in patients following injury. There is a marked rise in the counter regulatory hormones, viz., glu
The citric acid cycle functions in the mitochondria of eukaryotes and in the cytosol of prokaryotes. The Succinate dehydrogenase, the only membrane-bound enzyme in t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd