Explain about the endocrine system, Biology

Assignment Help:

Why is the endocrine system considered one of the integrative systems of the body? What is the other physiological system that also has this function?

The endocrine system is said to have integrative character as the hormones formed by the endocrine glands are substances that act at a distance and lots of them act in dissimilar organs of the body. So the endocrine glands receive information from some regions of the body and they can make effects in other regions providing functional integration for the body.

 


Related Discussions:- Explain about the endocrine system

#title.circulatory system, #question.what is the mechanism of circulatory s...

#question.what is the mechanism of circulatory system .

Reaction of the futile cycle, Reaction of the futile cycle:- A) An  ade...

Reaction of the futile cycle:- A) An  adequate level of  cAMP  stimulates formation of  the  inactive  'D'  form  of glycogen synthase and the active form of phosphorylase. Thu

Explain the role of cuvier in animal taxonomy, Explain the role of cuvier i...

Explain the role of cuvier in animal taxonomy? Cuvier (1769-1832) was critical of Lamarck's evolutionary concept which thereafter remained in oblivion for half a century. Cuvi

State the purposes of dressing, PURPOSES OF DRESSING A dressing can hav...

PURPOSES OF DRESSING A dressing can have a number of purposes, depending on the type, severity and position of the wound, although all purposes are focused towards promoting re

Described microbiology of air, Q. Described Microbiology of Air? Ans. ...

Q. Described Microbiology of Air? Ans. You would realize that air, by nature, does not contain a natural flora of microorganisms. All that comes into air is by accident and i

Define laser tweezers technology - pure culture techniques, Define Laser Tw...

Define Laser Tweezers Technology? In addition to above said classical methods, advance technologies can be used for obtaining pure cultures. Laser tweezers technology is useful

What are dna ligases, What are DNA ligases? How do these enzymes participat...

What are DNA ligases? How do these enzymes participate in the recombinant DNA technology? The DNA ligases are enzymes specialized in tying the complementary DNA chains that for

Explain insect resistant crops, Insect resistant crops (IRC) Should...

Insect resistant crops (IRC) Should reduce use of insecticides. This is beneficial to environment because: more beneficial insects around as they are not killed by ins

Fats, what are fats

what are fats

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd