Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about Cold Preservation - methods of food processing?
The metabolism of a living tissue is a function of the temperature of the environment. Low temperatures are used to retard chemical reactions and action of food enzymes and slow down or stop growth and activity of microorganisms in the food. Lower the temperature, the slower will be the above natural activities. Freezing and refrigeration are among the oldest methods of preservation. Mechanical ammonia refrigeration systems invented during 1875 allowed development of commercial refrigerated warehousing and freezing.
Temperature - Seed Dormancy Low temperature treatment is an essential prelude to germination in many seeds, and high temperature may be inhibitory at the time of germination.
What is the karyotype found in Down syndrome? Down syndrome is the aneuploidy that is a numeric alteration of chromosomes within the cells compared to the normal number of chro
Define the Role of Riboflavin in Respiratory Chain? Riboflavin catalyzes numerous oxidation-reduction reactions. Conversion of riboflavin to flavin mononucleotide (FMN) and the
Explain the term 'health' Mention any two ways of maintaining it. Why does a doctor administer tetanus antitoxin and not a tetanus vaccine to a child Injured in a roadside acci
What are the uses of squid fins? Fins are used by squids to move at low speeds. Their siphon is used when they require moving quickly.
Q What is the function of the skin in humans? The skin is the external covering of the body. In humans its major functions are protection and perception of information from the
Explain about the barrier function of epithelium and endothelium in corneal hydration. Barrier Function of Epithelium and Endothelium: Epithelium offers twice the resista
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain about the Dessicator? A dessicator is used to prevent an item from absorbing moisture. It is able to accomplish this because of a chemical, known as the dessicant, is h
Differentiate between neuropsychologists and neurologists Cooperation among neuroraudiologists, neurologists, and neuropsychologists has already led to the accomplishment of se
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd