Eretmochelys imbricata, Biology

Assignment Help:

Ivory was much in demand for production of a variety of jewellery and artifacts in the past. Reptile leather from crocodiles, lizards and snakes has quite a high demand for manufacture of sh oes and fancy goods. Furs from the felix (i.e. cat) family for export are obtained from many species including the leopard, lynx, ocelot, little spotted cat, margay and the leopard cat (Felis bengalensis ). There is high demand for these skins from Europe and Japan, although the overall market demand for these items has decreased due to the reduced popularity of furs as fashion items.

Bird feathers and some primate skins (e.g. black and white colobus) are used as items of adornment in many parts of the world, sometimes to indicated status of hierarchy. The skins of the black and white monkey (Colobus guereza) are used to make cloaks and head dresses for native people, and they are in demand for production of rugs and coats for the international trade.


Related Discussions:- Eretmochelys imbricata

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Placement of implant with improper axial angulation, Placement of implant w...

Placement of implant with improper axial angulation Surgical placement of the implant improperly can lead to a prosthetic rehabilitation that compromises esthetics and the dist

Coelentrates, classification of coelenterats?

classification of coelenterats?

What is oxidative phosphorylation, What is oxidative phosphorylation? O...

What is oxidative phosphorylation? Oxidative phosphorylation is  the process by which ADP is phosphorylated by Pi  to ATP  in  the  respiratory chain.

Define risk management, Define Risk management Risk management is def...

Define Risk management Risk management is defined  for the purposes of the Codex Alimentations Commission as  "the process, distinct from  risk assessment,  of weighing polic

Membrane that selects based on pore size, A transport process in which phys...

A transport process in which physical (hydrostatic) pressure drives part of a fluid through a membrane that selects based on pore size

What is meant by vaso-dilation, a) What is meant by 'vaso-dilation'? ...

a) What is meant by 'vaso-dilation'? b) What are the effects of vaso-dilation in the skin?   (a) Vaso-dilation is an enhance in diameter of small arterioles and

Define briefly about the seed proteins, Define briefly about the Seed Prote...

Define briefly about the Seed Proteins? Although a large number of plants produce seeds having protein contents in excess of 15%, only a few are utilized for food, eg. soybean,

Retention of soil moisture, Retention of Soil Moisture The movement of ...

Retention of Soil Moisture The movement of water into and within the soil, moisture storing capacity of soils and the availability of moisture to plants are governed by soil pr

Define factors which may lead to errors in count, Define Factors Which May ...

Define Factors Which May Lead To Errors in Count? There are many factors, which may lead to errors in count. (i) Counts may be low if the agar medium used in the technique d

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd