Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Collenchyma are one of the three major cell types in the plants; are elongated and have thicker walls than parenchyma cells and are usually arranged in strands; gives support and
Define Dietary modifications in the diet of the elderly? Loss of teeth due to increased decay of teeth and gums is common in aged person. Fitting dentures may also make chewin
How are ecological interactions classified? Ecological interactions are divided as intraspecific or interspecific interactions and as harmonious or inharmonious interactions.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Suturing - Endodontic Surgery a. Purpose of suturing: approximation of inside tissues and stabilize the flapped mucoperiosteum b. Major problem of suturing in oral t
how to make question on classification of Protozoan parasite
Reality Theory Developed in the 1960s by Willian glasser, a psychiatrist, reality therapists view human nature in terms of behaviour. They believe that human behaviour i
Explain the interaction of vitamin a with Zinc? Its deficiency interferes with vitamin A metabolism. It leads to a reduction in the synthesis of plasma proteins, particularly,
Define the interaction of vitamin c with lead and mercury? Vitamin C, lead and mercury: Iron alleviates lead toxicity but ascorbic acid is ineffective. Ascorbic acid alleviat
Q. Describe about defecation reflex? An example of a reflex having an autonomic (and somatic) component is the DEFECATION REFLEX: The rectum is generally empty, but when fec
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd