Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Besides the XY system are there other sex determination systems?
Some animals have a sex determination system dissimilar from the XY system.
The X0 system is the sex determination system of many insects; in this system the females are XX and the males have only one X chromosome (a conditioned shown by X0).
In birds, in some fishes and in lepidopterae (butterflies) insects the sex determination is made by the ZW system; in this system females are ZW and males are ZZ.
Explain Failing implant and biologic failure Failing implant : An implant that is progressively losing bone but is clinically stable (firm) can be defined as failing. Bio
It is mostly spread by sexual contact, blood transfers and from HIV infected mother to child.
Describe Briefly about the Type 1 Diabetes? In people with normal weight, Type1 Diabetes is not a major cause of death but it is an important contributor to morbidity and morta
What are food hydrocolloids? Food hydrocolloids are hydrophilic polymers of vegetable, animal, microbial or synthetic origin that generally contain many hydroxyl groups and ma
TYPES OF MENTAL DISORDER - 1 . Psychosis 2 . Neurosis 3. Personality & character disorders 1 . PSYCHOSIS - It effects mental capa
The passive transport of molecules across a membrane does not require an input of metabolic energy. Rate of the diffusion or transport is proportional to the concentration gradient
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What does it mean when a plasmid is cleaved with Hind III and Sca I? Does that mean that it opens up at those two locations and I have to insert whatever is complementary to it?
Define Criteria for Assessment of Vitamin B 12 Status? Low serum or plasma levels of vitamin B 12 should be the first indication of poor status and this could be confirmed
What is Lactate Lactate is transported to the liver in the Cori cycle (lactic acid cycle) and is converted to pyruvate. Hepatic gluconeogenesis then converts lactate ba
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd