Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Besides the XY system are there other sex determination systems?
Some animals have a sex determination system dissimilar from the XY system.
The X0 system is the sex determination system of many insects; in this system the females are XX and the males have only one X chromosome (a conditioned shown by X0).
In birds, in some fishes and in lepidopterae (butterflies) insects the sex determination is made by the ZW system; in this system females are ZW and males are ZZ.
Basic Structure of Heart The heart is small organ about the size of one's fist, located in the middle and slightly to the left of the mediastinum in the chest. The wider t
briefly explain filter feeding in holozoicanimals
how does the digestive system of an arthropod operate
Effects on Materials - Air pollutants Most air pollutants are reactive chemicals, so they react with most of the substances around. You may recall from your chemistry lessons
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is an ecosystem? An ecosystem is the system that composed of biotic and abiotic factors in interaction.
Q. Why is the cerebellum more developed in mammals that fly or jump? The cerebellum is the main brain structure that coordinates the movement and the equilibrium of the body. F
Explain the Control of Air Pollution a. Air belongs to everyone Need it to treat air pollution as public problem b. Air pollution is an inevitable concomitan
HEAR T OUTPUT The amount of blood pumped by heart per minute. Heart beat is 72. Pump out blood is 70 ml. This 72 × 70 = 5040 ml. ( 5 litres) blood is pumped in a minute.
Q. Food borne infections? Food borne infections, as you may recall reading earlier, are caused by the ingestion of pathogenic microorganisms that penetrate the intestinal muco
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd