Define the term - functional magnetic resonance imaging, Biology

Assignment Help:

Define the term - Functional magnetic resonance imaging

Functional magnetic resonance imaging (fMRI) is a recent development that permits simultaneous measurements of the brain structure and function. The technique relies on the same principles and the hardware as (structural) MRI described earlier. However, it takes advantage of the fact that active neurons require higher levels of oxygenated haemoglobin

 


Related Discussions:- Define the term - functional magnetic resonance imaging

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Traits, What happens to traits in a species that is evolving over time?

What happens to traits in a species that is evolving over time?

Explain elastase, Elastase The inactive  proelastase  is activated by t...

Elastase The inactive  proelastase  is activated by trypsin to the active form elastase. Elastase attacks  peptide  bonds  next  to  the  small amino  acid residues such  3s  g

The best describes calcium metals, Which of the following terms best descri...

Which of the following terms best describes calcium metals? Check all that apply. Molecule, element, matter, and compound.

What is the autotrophic hypothesis on the origin of life, What is the autot...

What is the autotrophic hypothesis on the origin of life? An autotrophic hypothesis on the origin of life asserts that the first living beings on earth were producers of their

Ecological adaptations in animals to desert environment, Ecological adaptat...

Ecological adaptations in animals to desert environment In response to scarcity of water, animats adcipt vario6s strategies to conserve or prevent loss of water. Most of the de

Define historical example for dynamical network, Define Historical example ...

Define Historical example for Dynamical Network? John Tyson constructed a nonlinear differential equation model representing the majority of the network of biochemical pathways

Behaviour change communication - iron deficiency anaemia, Define Behaviour ...

Define Behaviour change communication - iron deficiency anaemia? In communities that are illiterate and consequently ignorant of the consequences of nutrition disorders and the

Fats requirement in diabetes, Q. Fats requirement in diabetes? Fats: Th...

Q. Fats requirement in diabetes? Fats: The total fat recommended by WHO is less than 30% of the total calories. However in view of the widely prevalent Asian paradox in India,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd