Define the diet intervention for lactose intolerance, Biology

Assignment Help:

Define the Diet intervention for lactose intolerance?

Lactose is present in dairy products such as milk, cheese, yoghurt, ice cream etc.  Hidden sources of lactose may include bread, candy, cookies, biscuits, sauces, gravies,  soups etc. Hence, depending upon the amount of lactose an individual can handle, major or minor dietary restrictions may be imposed. Most lactose-intolerant children can digest yoghurt and buttermilk. On settling of the diarrhoea, they should begin with yoghort which is better tolerated as during its fermentation it becomes richer in bacteria which produces β-galactoside - this  hydrolyzes lactosc. Later milk (50 ml/kg/day) may be tried if tolerated.

Because dairy products are restricted or avoided, which are a major source of calcium,  an important mineral for children to develop strong bones, it is essential that other  foods rich in calcium be given to make up for the loss. Tofu, broccoli, pulses (hengal gram whole, horse gram, rajmah), nuts and oilseeds, green leafy vegetables (particularly amaranth-r, fenugreek), fish and sea foods are excellent sources of this mineral besides  dairy products. Further, use of lactose free formulas cull be advised, like soya feeds, amylase rich foods arc advised and rice based ORS advised. 

 


Related Discussions:- Define the diet intervention for lactose intolerance

Explain dna replication, Q. As a result of the DNA replication two DNA mole...

Q. As a result of the DNA replication two DNA molecules come into existence. Why is it not correct to assert that the two "new" DNA molecules are created? What is the name given to

Uptake of iron by enterocytes - non-haem iron absorption, Define Uptake of ...

Define Uptake of iron by enterocytes - Non Haem Iron Absorption? Ferrous iron traverses the brush border of the intestine better than the ferric iron. The mechanism of absorpti

Standardisation research of luria nebraska, Standardisation Research of Lur...

Standardisation Research of Luria Nebraska There are published manuals for the Luria Nebraska that define the battery in detail and provide information pertinent to validity,

Cnidarians: obelia, why is obelia considered to be of special interest in Z...

why is obelia considered to be of special interest in Zoology as an animal showing an intermediate grade of organisation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is deletion of cell, What is Deletion of cell? A deletion is simpl...

What is Deletion of cell? A deletion is simply when a tip or fragment of a chromosome breaks off and fails to reattach itself to the chromosome from which it came. The gene, or

Gradient hypohesis, please give me the expansion for ''gradient hypothesis'...

please give me the expansion for ''gradient hypothesis'' and the two types of gradient hypothesis in deelopment of animals in detailed manner

What do you mean by punch cards, Q. What do you mean by Punch cards? Pu...

Q. What do you mean by Punch cards? Punch cards are used when the number of taxa to be keyed out is large. In this type of cards the holes at numbers corresponding to a charact

State the term - neuropsychologists, State the term - neuropsychologists ...

State the term - neuropsychologists Disorders of speech, language, reading, writing, and mathematical abilities are understood in terms of linguistics and the psychology of lan

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd