Define repletion studies for studying nutrient requirement, Biology

Assignment Help:

Explain the Depletion and Repletion Studies for studying nutrient requirement?

This is an experimental procedure in which volunteer subjects are kept on a diet devoid of a particular nutrient, until such a time when they develop overt clinical signs of deficiency of the nutrient. The lowest level of the nutrient that reverses the clinical symptoms in all volunteer subjects is the minimum requirement for that nutrient. The minimum requirement for some B vitamins and ascorbic acid has been determined through this method.


Related Discussions:- Define repletion studies for studying nutrient requirement

Ecological significance - conservation of wildlife, Ecological Significance...

Ecological Significance - Conservation of Wildlife  Besides serving as a valuable genetic reservoir, each species interacts with other species and plays a role in the transfe

Merits and demerits of system classification, Q. Merits and Demerits of sys...

Q. Merits and Demerits of system classification? Merits The merits of this system\are as under: • Careful observation and original description of the genera from living

What are the digestive functions of the liver, What are the digestive funct...

What are the digestive functions of the liver? Besides making bile for release in the duodenum, the liver has other digestive functions. The venous network that absorbs nutr

Define energy requirements and dietary energy recommendation, Define Energy...

Define Energy Requirements and Dietary Energy Recommendations? Energy requirement, as you may recall studying earlier, is the amount of food energy needed to balance energy exp

Can mitosis occur in haploid cells, Can mitosis occur in haploid (n) cells?...

Can mitosis occur in haploid (n) cells? And in triploid cells? The mitotic cell division can happen in haploid (n) cells, diploid (2n) cells, triploid (3n) cells, etc. Mitosis

Which animals make tracheal respiration, Q. Which animals make tracheal res...

Q. Which animals make tracheal respiration? Is there a blood-like fluid that participates in this process? Arachnids and Insects are the arthropod animals that make tracheal re

Heart in fishes, Fishe s - Heart is 2 chambered 1 auricle & 1 ventr...

Fishe s - Heart is 2 chambered 1 auricle & 1 ventricle present. Sinus venosus, truncus or conus arteriusus present. Only impure blood come in heart so heart is venous he

What is congenital mitral stenosis, What is Congenital Mitral Stenosis ? ...

What is Congenital Mitral Stenosis ? The onset of symptoms or signs depends on severity of the stenosis, severe the stenosis earlier the presentation. With significant MS, the

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Inferior alveolar nerve, Inferior alveolar nerve Inferior alveolar ner...

Inferior alveolar nerve Inferior alveolar nerve repositioning to facilitate the placement of endosseous implants posterior to mental foramen is associated with very high incid

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd