Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Depletion and Repletion Studies for studying nutrient requirement?
This is an experimental procedure in which volunteer subjects are kept on a diet devoid of a particular nutrient, until such a time when they develop overt clinical signs of deficiency of the nutrient. The lowest level of the nutrient that reverses the clinical symptoms in all volunteer subjects is the minimum requirement for that nutrient. The minimum requirement for some B vitamins and ascorbic acid has been determined through this method.
Ecological Significance - Conservation of Wildlife Besides serving as a valuable genetic reservoir, each species interacts with other species and plays a role in the transfe
Q. Merits and Demerits of system classification? Merits The merits of this system\are as under: • Careful observation and original description of the genera from living
What are the digestive functions of the liver? Besides making bile for release in the duodenum, the liver has other digestive functions. The venous network that absorbs nutr
Define Energy Requirements and Dietary Energy Recommendations? Energy requirement, as you may recall studying earlier, is the amount of food energy needed to balance energy exp
Can mitosis occur in haploid (n) cells? And in triploid cells? The mitotic cell division can happen in haploid (n) cells, diploid (2n) cells, triploid (3n) cells, etc. Mitosis
Q. Which animals make tracheal respiration? Is there a blood-like fluid that participates in this process? Arachnids and Insects are the arthropod animals that make tracheal re
Fishe s - Heart is 2 chambered 1 auricle & 1 ventricle present. Sinus venosus, truncus or conus arteriusus present. Only impure blood come in heart so heart is venous he
What is Congenital Mitral Stenosis ? The onset of symptoms or signs depends on severity of the stenosis, severe the stenosis earlier the presentation. With significant MS, the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Inferior alveolar nerve Inferior alveolar nerve repositioning to facilitate the placement of endosseous implants posterior to mental foramen is associated with very high incid
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd