Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Reagents - Nelson Somogyi Method for Glucose Estimation?
1. Alkaline copper reagent
Alkaline A- Buy commercial from SDS chemicals etc
Alkaline B- Weigh 6.25 g anhydrous Na2CO3 and 6.25 g Na - K tartarate, 5 g sodium arsenate and 50 g Na sulphate anhydrous. Dissolve them in distilled water one by one and make vol to 250 ml.
Alkaline C- Mix reagents A (4 vol) and B (1 vol) just before use
Arsenomolybdate reagent
2. Dissolve 25 g ammonium molybdate in 450 ml water. Carefully add 21 ml concentrated H2SO4 with stirring. Dissolve 3 g Na2HAsO4.7H2O in 25 ml water and add to ammonium molybdate solution. Incubate at 37° C and store.
What is a phenotype? A phenotype is each observable characteristic of a living being conditioned by its genes. Some phenotypes may be changed by nongenetic factors (for instanc
Define Proteins in the immune system? Proteins such as γ-globulin serve to protect the body against foreign cells. The immunoglobulin produced by lymphocytes is the large polyp
What are the phytoplankton and the zooplankton? The Phytoplankton and the zooplankton are divisions of the plankton. The phytoplankton includes the autotrophic floating beings:
What are bacteriophages? Bacteriophages are viruses specialized in parasitism of bacteria. They are used in genetic engineering as molecular cloning vehicles to insert recombin
Budding - Types of Asexual Reproduction In reproduction through budding, small groups of cells form buds in some part or parts of the parent animal. The bud grows, differentia
RESPIR A TIO N IN FISHES - Respiratory organs are gills. In elasmobranchi 5-7 pairs of gills present, spiracles present. In Teleostomai 4 pairs gills present, covered
Select the processes assist in the maintenance of high levels of dissolved solutes in the interstitial spaces of the kidney medulla? A. Net flux of sodium ions from intracellul
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Triacylglycerols, cholesterol and phospholipids are associatively insoluble in aqueous solution. Thus, they are transported around the body in the blood as parts of lipoproteins.
Indications 1) Symptomatic patient with normal LV function (ejection fraction 2 0.5 at rest). If they are in class In or IV NYHA, surgery is recommended. In this group of pat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd