Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Define the Glucose Tolerance Test?
In Glucose Tolerance Test (GTT) if the blood sample is to be taken in the morning, patient is advised to follow fasting instructions i.e. patient will not eat food and drink water after dinner till morning or till blood sample is taken. A blood sample is drawn and fasting blood sugar (glucose) levels are checked. Then a specified amount of glucose dissolved in water is given to the patient to drink.
Enumerate about the Reitan Aphasia Screening Test This test serves two purposes in that it contains both copying and language-related tasks. As an Aphasia screening procedure,
Glycolysis Oxidation of glucose is called as glycolysis.Glucose is oxidized to either lactate or pyruvate. Under aerobic conditions and the dominant product within most tissues
In an experiment, isolated chloroplast thylakoids were incubated at pH 4.0 with ADP and inorganic phosphate (Pi) added to the medium and then transferred to a medium having pH 8.0.
What is Meiosis ? Meiosis starts with a diploid cell and forms four haploid, or 1n, (or "n") germ cells. These n germ cells fuse during fertilization with another germ cell to
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Describe Ventricular and Great Vessel Pressures? Ventricular Pressure RV and LV waveforms are similar in morphology but different in magnitude. The duration of systole an
After ovulation:- (a) what structure replaces the Graafian follicle (b) what hormone does it produce? (a) After ovulation, the follicle is replaced by the cor
Explain Dietary Assessment Criteria for Vitamin A? Several methods can be adopted for the dietary assessment of vitamin A such as food frequency, weekly or 3 day food weighmen
Reproduction and Life Cycles – Protozoan Asexual reproduction occurs in all protozoan through fission, budding and cyst formation. In this method the organism reproduces to fo
Are protozoan''s diploblastic or triploblastic
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd