Define the glucose tolerance test, Biology

Assignment Help:

Q. Define the Glucose Tolerance Test?

In Glucose Tolerance Test (GTT) if the blood sample is to be taken in the morning, patient is advised to follow fasting instructions i.e. patient will not eat food and drink water after dinner till morning or till blood sample is taken. A blood sample is drawn and fasting blood sugar (glucose) levels are checked. Then a specified amount of glucose dissolved in water is given to the patient to drink.


Related Discussions:- Define the glucose tolerance test

Enumerate about the reitan aphasia screening test, Enumerate about the Reit...

Enumerate about the Reitan Aphasia Screening Test This test serves two purposes in that it contains both copying and language-related tasks. As an Aphasia screening procedure,

Glycolysis, Glycolysis Oxidation of glucose is called as glycolysis.Glu...

Glycolysis Oxidation of glucose is called as glycolysis.Glucose is oxidized to either lactate or pyruvate. Under aerobic conditions and the dominant product within most tissues

Explain isolated chloroplast thylakoids, In an experiment, isolated chlorop...

In an experiment, isolated chloroplast thylakoids were incubated at pH 4.0 with ADP and inorganic phosphate (Pi) added to the medium and then transferred to a medium having pH 8.0.

What is meiosis, What is Meiosis ? Meiosis starts with a diploid cell a...

What is Meiosis ? Meiosis starts with a diploid cell and forms four haploid, or 1n, (or "n") germ cells. These n germ cells fuse during fertilization with another germ cell to

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe ventricular and great vessel pressures, Q. Describe Ventricular an...

Q. Describe Ventricular and Great Vessel Pressures? Ventricular Pressure RV and LV waveforms are similar in morphology but different in magnitude. The duration of systole an

What structure replaces the graafian follicle, After ovulation:- (a) ...

After ovulation:- (a) what structure replaces the Graafian follicle (b) what hormone does it produce?   (a) After ovulation, the follicle is replaced by the cor

Explain dietary assessment criteria for vitamin a, Explain Dietary Assessme...

Explain Dietary Assessment Criteria for Vitamin A? Several methods can be adopted for the dietary assessment of vitamin A such as food frequency, weekly or 3 day food weighmen

Reproduction and life cycles – protozoan, Reproduction and Life Cycles – Pr...

Reproduction and Life Cycles – Protozoan Asexual reproduction occurs in all protozoan through fission, budding and cyst formation. In this method the organism reproduces to fo

Phylum, Are protozoan''s diploblastic or triploblastic

Are protozoan''s diploblastic or triploblastic

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd