Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Food availability and Food Access?
Food availability: This refers to availability of necessary types of food in sufficient quantity, to the individual. The sources may be from domestic production, imports or donors. In other words, the food should be within the reach of the individual.
Food Access: Individuals have adequate incomes or other resources to purchase or baiter to obtain levels of appropriate foods needed to maintain consumption of an adequate diet/nutrition level.
Food utilization/consumption: This refers to how food is properly used, i.e. food preparation, food handling, food storage, balanced diet, nutritional care of vulnerable groups etc. Let us get familiarized with another term i.e. nutrition security.
Reproduction
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is signifying by "gene locus"? The Gene locus (locus means place) is the location of a gene in a chromosome that is the position of the gene in a DNA molecule
Q. Foods for phenylketonuria patient? The majority of foods for a PKU patient should come from the bottom half of the pyramid. As you may have observed, this contains the pheny
Explain about the Alitame - artificial sweeteners? Alitame (L-α-aspartyl-N-(2, 2, 4, 4-tetramethyl-3-thietanyl)-D-alaninamide), as illustrated in figure, is a sweetener based o
what is the responding variable in catalyst to change oil molecules
Q. Explain Percutaneous Interventions Over the last two decades, significant strides have been made in the field of Balloon Valvuloplasties both in terms of technique as well a
Induction of Defensive Barriers in Plants Several polymers deposited near surface of plants form an effective barrier against invasion or stress. Cuticle (which consists of a
What is the difference between the concepts of food chain and food web? The chain theory is a theoretical model to study the energy flux in ecosystems. In fact, in an ecosystem
Illustrate in detail about the Cell theory All living organisms are composed of cells, and they are the basic structural and functional units of life, just like the atom is a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd