Define food availability and food access, Biology

Assignment Help:

Define Food availability and Food Access?

Food availability: This refers to availability of necessary types of food in sufficient quantity, to the individual. The sources may be from domestic production, imports or donors. In other words, the food should be within the reach of the individual.

Food Access: Individuals have adequate incomes or other resources to purchase or baiter to obtain levels of appropriate foods needed to maintain consumption of an adequate diet/nutrition level.

Food utilization/consumption: This refers to how food is properly used, i.e. food preparation, food handling, food storage, balanced diet, nutritional care of vulnerable groups etc. Let us get familiarized with another term i.e. nutrition security.


Related Discussions:- Define food availability and food access

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is signifying by “gene locus”?, What is signifying by "gene locus"? ...

What is signifying by "gene locus"? The Gene locus (locus means place) is the location of a gene in a chromosome that is the position of the gene in a DNA molecule

Foods for phenylketonuria patient, Q. Foods for phenylketonuria patient? ...

Q. Foods for phenylketonuria patient? The majority of foods for a PKU patient should come from the bottom half of the pyramid. As you may have observed, this contains the pheny

Explain about the alitame - artificial sweeteners, Explain about the Alitam...

Explain about the Alitame - artificial sweeteners? Alitame (L-α-aspartyl-N-(2, 2, 4, 4-tetramethyl-3-thietanyl)-D-alaninamide), as illustrated in figure, is a sweetener based o

Responding variable, what is the responding variable in catalyst to change ...

what is the responding variable in catalyst to change oil molecules

Explain percutaneous interventions, Q. Explain Percutaneous Interventions ...

Q. Explain Percutaneous Interventions Over the last two decades, significant strides have been made in the field of Balloon Valvuloplasties both in terms of technique as well a

Induction of defensive barriers in plants, Induction of Defensive Barriers ...

Induction of Defensive Barriers in Plants Several polymers deposited near surface of plants form an effective barrier against invasion or stress. Cuticle (which consists of a

Difference between the concepts of food chain and food web, What is the dif...

What is the difference between the concepts of food chain and food web? The chain theory is a theoretical model to study the energy flux in ecosystems. In fact, in an ecosystem

Illustrate in detail about the cell theory, Illustrate in detail about the ...

Illustrate in detail about the Cell theory All living organisms are composed of cells, and they are the basic structural and functional units of life, just like the atom is a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd