Define about skeletal muscle, Biology

Assignment Help:

Define about skeletal muscle?

A. The binding of calcium ion to a binding site on the troponin molecule leads to a movement of the tropomyosin molecule that, in turn, exposes a binding site on the actin molecule for ATP.

B. The head of a myosin molecule is activated (energized) during the hydrolysis of ATP (which is bound to the myosin head) to cAMP and Pi.

 C. Consider the situation in which a myosin head is attached to its receptor site on the actin molecule.  For this situation, the binding of ATP to a binding site on the myosin head causes detachment of the myosin head from the actin molecule.

 


Related Discussions:- Define about skeletal muscle

Relaxin - reproduction, Normal 0 false false false EN-I...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Procedure for morphological characteristics of yeast cells, Procedure for M...

Procedure for Morphological Characteristics of Yeast Cells? Now carry out the exercise following the steps enumerated herewith: (1) Label the clean, non-greasy slide. Put fe

Types of blood vessel, Types of Blood Vessel Arteries Arteries ca...

Types of Blood Vessel Arteries Arteries carry blood away form the heart via the pulmonary artery and aorta. Arterioles As major arteries begin to branch , th

Explain left ventricle enlargement, Q. Explain Left Ventricle Enlargement? ...

Q. Explain Left Ventricle Enlargement? The left ventricle (LV) is ellipsoid in shape. It lies behind, and to the left of the right ventricle. Its long axis lies at about 45 deg

Determine the fate of manganese which is absorbed, Determine the fate of ma...

Determine the fate of manganese which is absorbed? Let us now study the fate of Mn which is absorbed. After absorption, Mn is complexed with albumin and transported to the l

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Contraceptive mechanism of the iud, Q. What is the contraceptive mechanism ...

Q. What is the contraceptive mechanism of the IUD? The IUD (intrauterine device) is a piece of plastic coated with copper that is put-in within the uterus by a doctor. Coppe

Precaution for quantitative determination of viable microbes, Define Precau...

Define Precautions for Quantitative Determination of Viable Microbes? 1. Dilution should be made carefully. 2. Use fresh sterile pipette for making each dilution. 3. Asep

Metazoa, Metazoa In the two kingdom classification, the unicellular 'a...

Metazoa In the two kingdom classification, the unicellular 'animals' used to be clubbed together under a single phylum Protozoa that constituted sub-kingdom - Protozoa. The re

Proteins, .please i need someone who can finish the assignment today , and ...

.please i need someone who can finish the assignment today , and one reliable who will not cancel the order at last time.in regards to the assignment, the are two pages of question

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd