Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define about skeletal muscle?
A. The binding of calcium ion to a binding site on the troponin molecule leads to a movement of the tropomyosin molecule that, in turn, exposes a binding site on the actin molecule for ATP.
B. The head of a myosin molecule is activated (energized) during the hydrolysis of ATP (which is bound to the myosin head) to cAMP and Pi.
C. Consider the situation in which a myosin head is attached to its receptor site on the actin molecule. For this situation, the binding of ATP to a binding site on the myosin head causes detachment of the myosin head from the actin molecule.
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Procedure for Morphological Characteristics of Yeast Cells? Now carry out the exercise following the steps enumerated herewith: (1) Label the clean, non-greasy slide. Put fe
Types of Blood Vessel Arteries Arteries carry blood away form the heart via the pulmonary artery and aorta. Arterioles As major arteries begin to branch , th
Q. Explain Left Ventricle Enlargement? The left ventricle (LV) is ellipsoid in shape. It lies behind, and to the left of the right ventricle. Its long axis lies at about 45 deg
Determine the fate of manganese which is absorbed? Let us now study the fate of Mn which is absorbed. After absorption, Mn is complexed with albumin and transported to the l
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the contraceptive mechanism of the IUD? The IUD (intrauterine device) is a piece of plastic coated with copper that is put-in within the uterus by a doctor. Coppe
Define Precautions for Quantitative Determination of Viable Microbes? 1. Dilution should be made carefully. 2. Use fresh sterile pipette for making each dilution. 3. Asep
Metazoa In the two kingdom classification, the unicellular 'animals' used to be clubbed together under a single phylum Protozoa that constituted sub-kingdom - Protozoa. The re
.please i need someone who can finish the assignment today , and one reliable who will not cancel the order at last time.in regards to the assignment, the are two pages of question
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd