Consequences on the bony structures, Biology

Assignment Help:

Q. Consequences on the bony structures?

Basal bone forms the dental skeletal structure. Wolff's law states that the bone remodels in relationship to the forces applied. With a change in the function of the bone everytime, a definite change occurs in the internal architecture and external configuration. When a tooth is lost, the lack of stimulation to the residual bone causes a decrease in trabeculae and bone density in the area, with loss in the external width, then height, and then of the bone volume. This issue, of utmost importance, has been ignored in the past by traditional dentistry. The patient is often not educated about the anatomic changes and the potential consequences of continued bone loss. The bone loss often accelerates on wearing a poorly fitting soft tissue-borne prosthesis. The continued atrophy of the posterior mandible eventually causes prominent mylohyoid and internal oblique ridges covered by thin, movable, unattached mucosa, prominent superior genial tubercles with the resulting elevation of prosthesis with contraction of mylohyoid and buccinator muscles serving as a posterior support. In a partially edentulous patient wearing a removable soft tissue-borne prosthesis, the natural abutment teeth, on which direct and indirect retainers are designed, are submitted to additional lateral forces. In addition, these teeth being often compromised by deficient periodontal support, many partial dentures are designed to minimize the forces applied to them. The result is an increase in mobility of the removable prosthesis and greater soft tissue support. These conditions protect the remaining teeth, but accelerate the bone loss in the edentulous regions. Thus implants have come out as an answer to these problems.


Related Discussions:- Consequences on the bony structures

What do you mean by tuberculosis, Q. What is tuberculosis? How is the disea...

Q. What is tuberculosis? How is the disease transmitted? Is there treatment for tuberculosis? The Tuberculosis is a disease caused by the Mycobacterium tuberculosis bacteria wh

Bone remodeling, Bone Remodeling Bone remodeling differs from the other...

Bone Remodeling Bone remodeling differs from the other means of bone structure alteration in that osteoblasts and Osteoclasts do not act independently but are coupled and bone

Explain the energy requirements during sepsis, Explain the Energy Requireme...

Explain the Energy Requirements during Sepsis? Patients suffering from septicemia with or without MODS are generally hyper-metabolic which results in weight loss. Critically il

Neuron, It arises from a one embryonic cell known as neuroblast Types of...

It arises from a one embryonic cell known as neuroblast Types of neuron:  According to number of process¬ (a) Unipolar: Only axon is there. e.g. mesencephalic nucleus. (b)

Explain syphillis, Syphillis  Parenteral penicillin G remains the drug ...

Syphillis  Parenteral penicillin G remains the drug of choice for treating all stages of syphilis. Primary, secondary or latent syphilis known to be of less than one year's dur

Define the lens transparency in metabolism of lens, Define the lens transpa...

Define the lens transparency in metabolism of lens. Lens Transparency: a. Transparency depends on avoidance of large transitions of refractory index. This is in other wor

Cytological approach, Write an essay on cytological approach in taxonomy.

Write an essay on cytological approach in taxonomy.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the magnesium requirements in body, Define the Magnesium Requirement...

Define the Magnesium Requirements in body? Let us learn about the magnesium requirements. Since plant foods are particularly high in magnesium, on a vegetarian diet with plenty

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd