Coadapted communities, Biology

Assignment Help:

From your studies in ecology, you must be aware that most ecosystems are quite complex consisting of several habitats and that habitats in turn are composed of microhabitats. Each microhabitat may accoinmodate diverse groups of organisms belonging to various species. Each species inhabiting a microhabitat has carved an ecological niche for itself. The ecological niche essentially tells you everything a species does and the relationships that the species enters into both with biotic and abiotic surroundings. Each species has an exclusive and a well defined niche and it can be said with any amount of certainty that no two species would have an identical ecological niche. This hypothesis was well explained by R.H. MacArthur, in an elegant study of five species of warbler birds of genus Dendroica living together in a single spruce tree. All the five species shared the same food insect, the spruce bud worms at the same time. But each species had a well defined  niche in the spruce tree. The myrtle warbler was most time confined to the lichen covered branches, near the trunk of the tree. The black burnian warbler was always found on the other parts of the uppermost branches, whereas the black-throated green warbler fed mostly from branches of intermediate height. The other two warblers Cape May warbler and bay breasted warbler also fed on different parts of the same tree, but their feeding zones overlapped with those of the three species mentioned first. The last two species would visit the spruce tree only when there was an outbreak of a spruce bud worms, hence called fugitive or species a having nomadic existence. Essentially, the number of birds of these two species visiting the spruce bud trees depended on the availability of feed organisms, the spruce bud worms.

If there were to be an outbreak of spruce bud worms, the two warblers, were found in appreciable numbers. The occurrence of all five species of warblers together depended on the increase in the carrying capacity of spruce trees, made possible by the increas? in the number of spruce bud worms. Otherwise only three species were found, each occupying different part of the tree. The three different parts of the tree could be characterised as distinct ecological niche. Each one of them is characterised by its own microclimatc, the components of which are temperature, light, relative humidity etc. For instance the lower branches may have less sunlight, lower temperature and high relative humidity as compared to the upper branches which may have more temperature, more light and less humidity. There might be a slight overlap in the niche of any of the three species. However, that does not imply that the entire ecological niche of any of the three species is identical with that of another.

Although the spruce bud worms are the cornmoil food for all the species, each specics also feeds on other insects characteristic of that part of the tree.


Related Discussions:- Coadapted communities

Movement of molecules into and out of a cell, how does a plasma membrane re...

how does a plasma membrane regulate movement of molecules into and out of a cell? is it polarity, integrity, permeability, or solubility? these are my choices

Explain carboxypeptidase, Carboxypeptidase The  inactive  zymogen  proc...

Carboxypeptidase The  inactive  zymogen  procarboxypeptidase  is  activated  by  trypsin .The further action on the polypeptides is carried out by carboxypeptidase which  attac

Angiosperms, Angiosperms  are the flowering plants. They first appeared at ...

Angiosperms  are the flowering plants. They first appeared at least 110 million years ago from the unknown gymnosperm ancestor, these flowering plants have risen to dominance in th

Methods including quantification of rna species, 1.   Northern blotting ...

1.   Northern blotting The quantity of rna species can be quantified by calculating the quantity of rna through northern blotting which provide size and sequence information

Explain centrifuge - microbiological apparatus and equipment, Explain the C...

Explain the Centrifuge - Microbiological Apparatus and Equipments? Centrifuge is used for separating the substance in liquid or concentrating the microorganisms on the basis of

What is the kind of digestion occurs in cnidarians, Q. What is the kind of ...

Q. What is the kind of digestion that occurs in cnidarians? These animals have a digestive cavity and they make intracellular and extracellular digestion. The extracellular dig

Determine the term clade, Determine the term Clade? In cladistic taxono...

Determine the term Clade? In cladistic taxonomy, how groups of animals are related to each other. It includes the ancestral group and all of the other groups, or lineages, of a

Internal budget - nutrient budgets, Internal budget - Nutrient Budgets ...

Internal budget - Nutrient Budgets This is concerned with the circulation of nutrients through various biotic and abiotic compartments of a given ecosystem. In other words the

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd