classification of animal, Biology

Assignment Help:
example of pisces

Related Discussions:- classification of animal

Describe any three adaptations of mangroves, Name and describe any three ad...

Name and describe any three adaptations of mangroves to the conditions prevailing in the Sunderbans.

File & chemical removal of gutta percha-endodontics, File  & chemical remov...

File  & chemical removal of gutta percha: -    K-type file & chloroform is the best choice in small and curved canals. -    The pulp chamber floated with chloroform, then k-typ

Nutrition, Why is holophytic nutrition a mode of autotrophic nutrition

Why is holophytic nutrition a mode of autotrophic nutrition

Anomalies related to oral cavity, Anomalies Related to Oral Cavity: Un...

Anomalies Related to Oral Cavity: Under these anomalies we will briefly discuss the cleft lip and cleft palate.  You must have seen and/or nursed a baby born with a cut on

What is a homologue, Single chromosome of a pair is known as homologue.In H...

Single chromosome of a pair is known as homologue.In Homologous pair two identical chromosomes are there. Each one chromosome in a Homologous pair is known as Homologue.

Explain saquinavir, Explain Saquinavir Saquinavir (SQV, Fortovase, Invi...

Explain Saquinavir Saquinavir (SQV, Fortovase, Invirase) - When administered as a single protease inhibitor, a soft-gel preparation (Fortovase) with improved bioavailability an

Define integrity of epithelial tissues, Define Integrity of Epithelial Tiss...

Define Integrity of Epithelial Tissues? Vitamin A is essential for the integrity of the mucous-secreting cells. In fact vitamin A maintains the health of epithelial cells that

Objectives of the earth pressure and retaining structures, What are the obj...

What are the objectives of the earth pressure and retaining structures? After knowing all concepts about the same you should be able to learn: a. Know the field situations w

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain cyanotic heart disease breifly, Explain Cyanotic Heart Disease brei...

Explain Cyanotic Heart Disease breifly? Presence of cyanosis means deoxygenated blood reaching the systemic circulation bypassing the lungs i.e., right to left shunt. Uniform c

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd