Biogeochemical cycle, Biology

Assignment Help:

The cyclic exchange of nutrient material between organisms and non-living  environment is called biogeochemical  cycle ,'geo means earth: ''chemical' means chemical elements, thus biogeochemical cycle can be explained as cycle paths in which circulation of all essential elements takes place from the environment  to the organisms and back to the  environment  some important biogeochemical cycles  are as follows:

1.         Water  cycle or hydrological cycle

2.         Oxygen cycle

3.         Nitrogen cycle

4.         Carbon cycle

5.         Sulphur cycle

6.         Phosphorus cycle

The first are gaseous cycles as they circulate between land  and atmosphere where as the last one is sedimentary cycle it does not the atmosphere.

 

 


Related Discussions:- Biogeochemical cycle

Determine fluids and electrolyte need at high altitude, Determine the Fluid...

Determine the Fluids and Electrolyte Requirement at high Altitude? In addition to cold induced diuresis, hyperventilation together with a dry environment at HA makes an individ

Invertebrates, Are chaetopterus species coelomate?

Are chaetopterus species coelomate?

Hemodynamic measurements of tricuspid stenosis, Q. Hemodynamic Measurements...

Q. Hemodynamic Measurements of tricuspid stenosis? Unless one suspects it clinically and echocardiographically, and plans the hemodynamic study - diagnosis of tricuspid stenosi

Minerals requirements during congestive cardiac failure, Q. Minerals requir...

Q. Minerals requirements during congestive cardiac failure? Minerals: Since sodium and potassium are the major electrolytes associated with oedema, it is important that sodium

What is the significance of the epiglottis in human body, a) What is the si...

a) What is the significance of the epiglottis in human body? b) What happens to the glycogen concentration in the liver cells when the level of adrenaline enhances in the blood

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Traumatic reticuloperitonitis (trp), Tr aumatic reticuloperitonitis (TRP) ...

Tr aumatic reticuloperitonitis (TRP) It is also known as traumatic gastritis, hardware disease or traumatic reticulitis. Et i o l o g y : Frequentl

Explain ventricular septal defects vsd chsude technique, Explain Ventricula...

Explain Ventricular septal defects VSD Chsude Technique ? Ventricular septal defects are closed on cardiopulmonary bypass. Approach is through median stemotomy. Ascending aort

Formation of an h+ gradient, All of the electron carrier in the electron tr...

All of the electron carrier in the electron transport chain interact according to their redox potentials.  Every time whereas an electron transfers occurs, the accepting carrier ha

Enumerate the term - brain behaviour functioning, Enumerate the term - brai...

Enumerate the term - brain behaviour functioning The brain may be thought of as a "dependant variable" that is shaped in part by the facilitative stimulation that is experience

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd