Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The cyclic exchange of nutrient material between organisms and non-living environment is called biogeochemical cycle ,'geo means earth: ''chemical' means chemical elements, thus biogeochemical cycle can be explained as cycle paths in which circulation of all essential elements takes place from the environment to the organisms and back to the environment some important biogeochemical cycles are as follows:
1. Water cycle or hydrological cycle
2. Oxygen cycle
3. Nitrogen cycle
4. Carbon cycle
5. Sulphur cycle
6. Phosphorus cycle
The first are gaseous cycles as they circulate between land and atmosphere where as the last one is sedimentary cycle it does not the atmosphere.
Determine the Fluids and Electrolyte Requirement at high Altitude? In addition to cold induced diuresis, hyperventilation together with a dry environment at HA makes an individ
Are chaetopterus species coelomate?
Q. Hemodynamic Measurements of tricuspid stenosis? Unless one suspects it clinically and echocardiographically, and plans the hemodynamic study - diagnosis of tricuspid stenosi
Q. Minerals requirements during congestive cardiac failure? Minerals: Since sodium and potassium are the major electrolytes associated with oedema, it is important that sodium
a) What is the significance of the epiglottis in human body? b) What happens to the glycogen concentration in the liver cells when the level of adrenaline enhances in the blood
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Tr aumatic reticuloperitonitis (TRP) It is also known as traumatic gastritis, hardware disease or traumatic reticulitis. Et i o l o g y : Frequentl
Explain Ventricular septal defects VSD Chsude Technique ? Ventricular septal defects are closed on cardiopulmonary bypass. Approach is through median stemotomy. Ascending aort
All of the electron carrier in the electron transport chain interact according to their redox potentials. Every time whereas an electron transfers occurs, the accepting carrier ha
Enumerate the term - brain behaviour functioning The brain may be thought of as a "dependant variable" that is shaped in part by the facilitative stimulation that is experience
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd