Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
BEE DISEASES -
Suffer from nosema diseases caused by Nosema apis.
SILK WORM DISEASES -
Pebrine disease caused by Nosema.
Blood Pump : Ideal Characteristics 1) I should be able to pump up to seven litres of blood per minute. 2) It should not damage cellular and cellular components of blo
genral charecter and classificatin of porifera
Carbohydrates are the next important nutrients as they have to perform a variety of functions such as: 1) Provide major source of energy 2) Breakdown of fatty acids and preve
CHARACTERISTIC S OF HORMONES - (1) They are regulatory chemicals that control and coordinate functions of different body organs. (2) Hormones are formed by ductle
Explain in brief about Polymers In comparison to metals and ceramics, polymers are weak and flexible. These are not popular as dental implant materials. Examples of polymeric m
Describe the Clinical Evaluation MVP Murmur in details? Characteristic: Mid systolic click followed by a late systolic murmur which usually extends to A2. The click may be abse
A haploid cell contains: A.one half of a complete set of chromosomes B.several complete sets of chromosomes C.the correct number of chromosomes D.two complete sets of chromosomes E
What are the five conditons that can cause evolution to take place?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How is excretion done in amphibians? Adult amphibians have kidneys that filter blood. Nitrogen waste is excreted as urea so amphibians are ureotelic beings. The aquatic, lar
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd