Bee and silkworm diseases, Biology

Assignment Help:

BEE DISEASES -

Suffer from nosema diseases caused by Nosema apis.

SILK WORM DISEASES -

Pebrine disease caused by Nosema.


Related Discussions:- Bee and silkworm diseases

Ideal characteristics of blood pump-cardio pulmonary bypass, Blood Pump :  ...

Blood Pump :  Ideal Characteristics 1) I should be able to pump up to seven litres of blood per minute. 2) It should not damage cellular and cellular components of blo

Invertibreats, genral charecter and classificatin of porifera

genral charecter and classificatin of porifera

Carbohydrates, Carbohydrates are the next important nutrients as they have ...

Carbohydrates are the next important nutrients as they have to perform a variety of functions such as: 1) Provide major source of energy 2) Breakdown of fatty acids and preve

Characteristics of hormones, CHARACTERISTIC S OF HORMONES - (1)      T...

CHARACTERISTIC S OF HORMONES - (1)      They are regulatory chemicals that control and coordinate functions of different body organs. (2)      Hormones are formed by ductle

Explain in brief about polymers, Explain in brief about Polymers In com...

Explain in brief about Polymers In comparison to metals and ceramics, polymers are weak and flexible. These are not popular as dental implant materials. Examples of polymeric m

Describe the clinical evaluation mvp murmur in details, Describe the Clinic...

Describe the Clinical Evaluation MVP Murmur in details? Characteristic: Mid systolic click followed by a late systolic murmur which usually extends to A2. The click may be abse

Copies of a single chromosome, A haploid cell contains: A.one half of a com...

A haploid cell contains: A.one half of a complete set of chromosomes B.several complete sets of chromosomes C.the correct number of chromosomes D.two complete sets of chromosomes E

Evolution conditions, What are the five conditons that can cause evolution ...

What are the five conditons that can cause evolution to take place?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How is excretion done in amphibians, Q. How is excretion done in amphibians...

Q. How is excretion done in amphibians? Adult amphibians have kidneys that filter blood. Nitrogen waste is excreted as urea so amphibians are ureotelic beings. The aquatic, lar

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd