Are protozoans diploblastic or triploblastic?, Biology

Assignment Help:
Are protozoans diploblastic or triploblastic ?

Related Discussions:- Are protozoans diploblastic or triploblastic?

Importance of counselling for diabetic patient, Q. Importance of counsellin...

Q. Importance of counselling for diabetic patient? Diabetes is a life-long illness. Life style modification and precautions taken by the patient can prevent complications and i

Explain coronary heart disease, Apart from any inherited tendency towards c...

Apart from any inherited tendency towards coronary heart disease, what are thought to be the four major risk factors?  The four major risk factors for coronary heart disease ar

Structure and content of neuropsychological battery, Structure and Content ...

Structure and Content of NEUROPSYCHOLOGICAL BATTERY The battery contains 269 items, each of which may be scored on a 2- or 3- point scale. A score of 0 indicates normal perform

Amoeboid movement, Normal 0 false false false EN-IN X...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Three irreversible reactions in the glycolytic pathway, Name the three irr...

Name the three irreversible reactions  in the glycolytic pathway. The three irreversible reactions in the glycolytic  pathway are : Glucose → Glucose-6-phosphate Fructose

Which features shared by typical birds and mammals, Which of the following ...

Which of the following characteristics is not shared by typical birds and mammals? A) Four chambered heart B) Milk production C) Four limbs D) Endothermy E) Insulating skin structu

Explain about the simple proteins, Explain about the Simple Proteins? S...

Explain about the Simple Proteins? Simple proteins are those that are made of amino acid units just joined by peptide bond. Upon hydrolysis they yield a mixture of amino acids

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

An the heat capacity of water, Q. Can the heat capacity of water be conside...

Q. Can the heat capacity of water be considered small or large? What is the biological consequence of that characteristic? From Thermology it is acknowledged that the quantity

Cardiovascular, Describe the process of excitation-contraction coupling (EC...

Describe the process of excitation-contraction coupling (ECC) in the heart. How do adrenaline, noradrenaline and acetylcholine alter heart rate and or force?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd