Age distribution - population parameters and regulation, Biology

Assignment Help:

Age Distribution - Population Parameters and Regulation

It is obvious that individuals in a population will be of different age groups. Relative numbers of young and old individuals in a population will significantly influence the behaviour of a population such as natality and mortality. The age structure of any population can be classified into three categories, i.e. pre-reproductive, reproductive and post-reproductive ages. Mortality usually varies with age as chances of death are more in early pre- reproductive and late post-reproductive periods. Likewise, natality is restricted to the reproductive age of individuals in a population.

The relative duration of these ages in proportion to life span is different in different organisms. For example, in modern man the three 'ages' are relatively equal in length, about one third of the life span. In comparison, the primitive man had much shorter post reproductive period. Many animals and plants have quite long pre-reproductive period. For example, a locust in its seventeen years of life has an extremely long development history with adult life lasting only less than a year.


Related Discussions:- Age distribution - population parameters and regulation

Explain management of ledge - non-surgical endodontic, Explain Management o...

Explain Management of Ledge - Non-Surgical Endodontic Retreatment Place a bend of approximately 45 degree in the apical 1-2 mm of a #15 to 25 file. By gentle reciproca

State the swinging flashlight test, State the Swinging Flashlight Test ...

State the Swinging Flashlight Test The patient looks into the distance while the examiner shines a bright light first into one eye for a few seconds and then the other. As the

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is difference between analogous and homologous organs, What is the dif...

What is the difference between analogous and homologous organs? The Characteristics of different species are said to be analogous when having the same biological function, for

Explain about the neuro trauma, Explain about the Neuro Trauma? Neuro o...

Explain about the Neuro Trauma? Neuro or head trauma includes brain injury, skull fractures, extraparenchymal or internal brain haemorrhage, Brain injury can be divided into th

Explain positive staining technique, Explain Positive Staining Technique? ...

Explain Positive Staining Technique? Here, a stain has a positively charged chromophore that gets attached to the negatively charged outer surface of the microbial cell and thu

How cells are studied, How cells are studied We learnt about the evolut...

How cells are studied We learnt about the evolution of the cell and a historical account of the growth of cell biology. In this section, you will study about the various tools

.rRNA , rRNA structure and synthesis assignment

rRNA structure and synthesis assignment

Berry - development of seed, Berry - Development of Seed In a berry mu...

Berry - Development of Seed In a berry much of the pericarp is fleshy or juicy. In tomato Lycopersicon esculentum even the placenta on which the seeds are borne is fleshy. The

Explain about steatorrhoea, Q. Explain about Steatorrhoea? Steatorrhoea...

Q. Explain about Steatorrhoea? Steatorrhoea is a symptom of the disorders of fat metabolism and malabsorption syndrome and can be defined as n condition of foul-smelling bulky

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd