Write functions and steps for various window applications

Assignment Help Basic Computer Science
Reference no: EM1367068

1. a) Enumerate the functions and steps involved in various window applications.

2. a) What is mail merge? Enumerate the steps involved in mail merge.

b) Briefly describe the internet tools and discuss how to use the internet.

3. a) Discuss the names and functions of the tools of the standard tool bar and formatting toolbar.
b) Discuss the commands for applying the following formatting concepts to the document:
i) Auto format
ii) Header and footer
iii) Numbering pages
iv) Inserting section break
v) Aligning text

Reference no: EM1367068

Questions Cloud

Write pseudocode for finding grade of a student : Write pseudocode for finding grade of a student given his/her total score. The program must display a grade of A if the score is above 85, a B if it is between 85 and 75, a C.
Determine the risk : Explain how Jenny might optimally invest $1,000,000 in a portfolio of financial assets to earn an expected return of 14 percent per annum and determine the risk that she would face in doing so.
Describing laws of demand and supply : Describe the law of demand. Why does a demand curve slope downward? What are the determinants of demand? What happens to the demand curve when each of these determinants changes?
Practice of strategic planning : Describe what is meant by the concept and practice of the strategic planning.
Write functions and steps for various window applications : Write down the functions and steps involved in various window applications. What is mail merge? Enumerate the steps involved in mail merge.
Imperfect competitive market : In the imperfect competitive market of jeans, Lean Jeans, Inc., recently offered rebates of $1 off the regular $50 price. Quantity sold jumped 4 more jeans from the previous 100 figure the previous month.
Calculating the quarterly payment : A student lend $4000 from a credit union toward buying a car. The interest rate on such a loan is 14 percent compounded quarterly, with payments due each quarter.
Describing law of diminishing marginal productivity : What is the law of diminishing marginal productivity? How does it differ from average productivity?
Complications of cancer : Explain at least three complications of cancer, the side effects of treatment, and methods to lessen physical and psychological effects.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Compute average probability of symbol error of signalling

Consists of additive noise w(t) as the sample function of a gaussian process with zero mean and power spectral density No/2. Calculate the average probability of symbol error for this method of signalling

  Encrypting a message by crypto device

Crypto device encrypts every message into 20 bits of ciphertext.

  Information security problem or issue in organisation

Illustrate how the work breakdown structure would identify and plan an information security problem or issue in the organisation.

  Identify people to interview to learn new training activity

Draft a project scope statement for the TIMS system and describe the constraints. She said be specific. Need to identify the people want to interview to learn more about the new training activity, and prepare a list of the questions I will ask.

  Design two level and-or and not circuit

Design a two level AND , OR ,NOT circuit for the following I/O priority circuit,when the ack input is true ack will be made true for the smallest j for which req is true.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Develop requirements traceability matrix

The GlobalUBid.Com Case Study will be used to develop a requirements traceability matrix describing and following the life of requirements in both the forward and backward direction.

  Explain components of information systems

Using the three components of information systems and the complementary assets concepts, discuss why some companies achieve better results with information systems than others.

  Find the gradient magnitude and gradient direction

Consider the sub-image shown above. Find the gradient magnitude and gradient direction at the center entry using the following operators.

  Exploit wildcard feature in order to cheat system

How could Dave, dishonest teller, exploit the wildcard feature  to cheat the system? Dave would want to concentrate on vouchers that are nearly one year old since such vouchers are likely to have been lost.

  Determining accurate formula using undetermined coefficients

Determine a more accurate formula for f'(t) using method of undetermined coefficients. Let's say the formula is of the form f'(t)= Af(t + 2h) + Bf(t + h) - Bf(t - h) - Af(t - 2h).

  Compute the cost of sorting the relation in seconds

Suppose a flash storage device is used instead of disk, and it has a seek time of 1 microsecond and a transfer rate of 40 MB per second. Recompute the cost of sorting the relation in seconds with.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd