Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Write a program to manage a dictionary. Your dictionary should be stored on a text file named diction.txt and consist of an alphabetized list of words, one per line. When a user enters a word, scan the dictionary looking for the word. If the word is in the dictionary, say so. If not, display the dictionary word immediately preceding and the word immediately following so that user can see words that are close in spelling. Then ask whether the user wants to add this new word to the dictionary. If the answer is yes, do so and go back to request the next word.
To insert a word into a file in alphabetical order, simply copy the file to a new temporary file named diction.tmp and move words one at a time from the temporary file back to the original file, inserting the new word when you reach its correct position alphabetically. Turn in your source code and your diction.txt file.
The load master for a freighter wants to determine the mix of cargo to be carried on the next trip. The ship's volume limit for cargo is 100,000 cubic meters, and its weight capacity is 2,310 tons.
When deciding whether to buy and implement digital dashboard or management cockpit sometimes a feasibility study is conducted. Explain the different kinds of feasibility studies.
Draw a diagram showing how the 68000 processor connects to a 64 KWord (64KB even + 64 KB odd) RAM IC. Show all relevant address, data, and control signals and label them correctly. Also show the MAD (memory address decoder) in your circuit diagram.
Determine the probability that the contention ends on round k, and compute the mean number of rounds per contention period?
Using Pseudocode, create your own function that accepts one input parameter and returns a float number. You decide the theme.
Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.
Sufficient to assure with 90% confidence that the learned perceptron will have true error of at most 5%. Does this bound seem realistic?
Produce an algorithm, pseudocode code and flowchart for the following probelm: A customer in a store is purchasing five items. Design a program that ask for the price of each item, and then displays the subtotal of the sale, the amount of sales ta..
Discuss any two major security flaws in US or anywhere, one of which is a violation of Integrity, while the other is a violation of Confidentiality, with clear explain.
A decision maker observes a discrete-time system which moves between states {s1,s2,s3,s4} according to the following transition probability matrix?
The args designate the range [lo, hi]. If lo > hi, then that designates the empty range (no numbers), in which case outputA returns without outputting any numbers. Otherwise, outputA outputs all the numbers in the range that are interesting.
Assume we have a directed acyclic graph G = (V, E) with real-valued edge weights and two distinguished vertices s and t. Explain a dynamic programming approach for ?nding a longest weighted simple path from s to t.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd