Write a program to find the nth busalem number

Assignment Help Basic Computer Science
Reference no: EM13307971

BuSalem Numbers starts with 1 1 1 (first, second and third BuSalem numbers respectively) then every other number is the summation of the last three numbers, hence the fourth BuSalem number is 1+1+1 = 3, the Fifth Busalem number is 1+1+3=5, the sixth BuSalem number is 1+3+5=9 and so on.

write a program to find the nth BuSalem number. You must use functions.

 

Reference no: EM13307971

Questions Cloud

What technologies should be used to secure these areas : On what areas should the security policy focus (physical security, data security, auditing, passwords, and so forth), and what technologies should be used to secure these areas?
How much work is done on it by the external force : A -50 nC charged particle is in a uniform electric field {E} = (10 V/m, east). An external force moves the particle 1.0 m north, then 6.0 m east, How much work is done on it by the external force
How long will it take for the country mineral reserves : If this is so, how long will it take for the country's mineral reserves to be depleted? Solve using Excel.
Find how much power does it produce : A reversible engine takes in 555 J per second and exhausts 482 W, How much power does it produce?
Write a program to find the nth busalem number : write a program to find the nth BuSalem number. You must use functions.
The reflection process as a mindmap : Alternative submission method
Compare to the theoretical means : check the computed means and compare to the theoretical means (hint use the two previous equations to write two equations with two unknowns then solve for the unknowns by hand.)
What is the minimum number of lines : You are making a diffraction grating that is required to separate the two spectral lines in the sodium D doublet, What is the minimum number of lines you should have on the grating
Explain deployment of a product are the first steps : The design, development, and deployment of a product are the first steps toward a finished product ready for distribution in the marketplace. The next step is the evaluation of the user experience in order to gather data on the usability of the pr..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  What are the features and define the values for parameters

What are the features you would consider essential if you were designing your perfect amplifier

  Write the method getlongestrun that takes as its parameter

Write the method getLongestRun that takes as its parameter an array of boolean values representing a series of coin flips. The method returns the starting index in the array of a run of maximum size

  Support day-to-day working activities of organization

____are used to support day-to-day working activities of organization. Typical decisions involve e-commerce transaction acceptance, approval of personal loans by bank.

  How different backgrounds work with the fonts

Your presentation should include information about font size and icons, how they look with different backgrounds, and how different backgrounds work with the fonts.

  Find optimal production amounts using graphical method

The daily demand for solution A lies between 30 and 150 units, and that for solution B between 40 and 200 units. Find the optimal production amounts of A and B using the Graphical Method.

  Create a java or c sharp application that simulates

Create a Java or C# application that simulates

  Design modular program asks how many tickets each class

There are three seating categories at a stadium

  Write a program that will continuously prompt the user grade

Write a program that will continuously prompt the user for a grade (in the range of 0 to 100) until a sentinel value of 999 is entered. The program will then display the average of all grades entered, formatted to 1 decimal place. Assume the grades a..

  Which of the following are advantages of the osi model

The OSI model was designed to provide a framework for networking and internetworking standards. Which of the following are advantages of the OSI model?

  What is the output of the following sequence of loops

What is the output of the following sequence of loops

  How can you quickly investigate and collect digital evidence

Prepaid cell phones make forensic investigation much hard. Discuss how can you quickly investigate and collect digital evidence for a crime what involves a phone call.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd