Write a program for line clliping

Assignment Help Basic Computer Science
Reference no: EM13219740

Write a program for line clliping. Take co-ordinate of 2 point as input and also take 4 co-ordinates of window. It should clip the line outside the window. Dont use built in function like line or rectangle to draw line or rectangle.Use dda line algorithm. The program should work.

Reference no: EM13219740

Questions Cloud

What drives excessive technology investments in each model : Explain how either the Newhouse model or the Physician Workshop model could explain why hospitals might inefficiently over-invest in expensive, new technologies. What drives excessive technology investments in each model
Write the definition of a class counter containing : Write the definition of a class Counter containing: An instance variable named counter of type int An instance variable named limit of type int . A constructor that takes two int arguments and assigns the first one to counter and the s..
Calculate and display running total of yesterday receipts : calculate and display the running total of yesterday's receipts. The program should use the method calculate-Charges to determine the charge for each customer.
Compute the maximum safe diameter w of the port : The vessel will contain gases at pressures up to 210.0 MPa. The student's design calls for an observation port on the side of the vessel (see diagram below). The bolts that hold the cover of this port onto the vessel can safely withstand a force o..
Write a program for line clliping : Write a program for line clliping. Take co-ordinate of 2 point as input and also take 4 co-ordinates of window. It should clip the line outside the window. Dont use built in function like line or rectangle to draw line or rectangle.Use dda line al..
Determine what is the amount of excess reserrves : This bank can safely expand its loans by what amount c.by expanding its loans by this amount in part (b), its checkable deposits would expand to what amount (if all loans were made to ch3ecking account customers)
What stable monetary policy has been highly erratic : The velocity of M1 money has moved erratically in the past several years because Answer of low and stable rates of inflation of regulatory changes allowing banks to pay interest on checkable deposits interest rates have been stable monetary policy..
How would this ip address be expressed : How many possible hosts would there be on the above network if all usable addresses were assigned (show your work)? d. How would this IP address be expressed using CIDR notation (show your work)? e. What is the range of the block of addresses this..
Explain acid in vinegar calculate the concentration : Assuming that acetic acid (HC2H3O2) has one acidic H and is the only acid in vinegar; calculate the concentration of HC2H3O2 in this sample. (Ka=1.8e-5)

Reviews

Write a Review

Basic Computer Science Questions & Answers

  What are three separate methods of referring

What are three separate methods of referring to your local computer on a network?

  What bit pattern will be in memory cell

What bit patterns will be in registers 0, 1, and 2 when the machine halts? What bit pattern will be in the memory cell at address 30 when the machine halts?

  Condition to resume sending messages related to application

Give an example that illustrates why P must not be allowed to do so and state a condition that defines when P may resume sending messages related to application.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Is this a successful application of decision support systems

Computers are used in business to provide information and assist management in analyzing data to enhance decision-making. Based on your example, is this a successful application of Decision Support Systems?

  Required value for the move command

Shape_index is a required value for the move command. It is the index of the shape in the shape data arrays that you wish to move. It should range between 0 and MAX_SHAPES - 1. Be sure to validate the index.

  Find monthly break-even volume for company

Variable cost per pound of fertilizer is $0.15. Evergreen sells fertilizer for $0.40 per pound. Find out the monthly break-even volume for company.

  How cost of box is evaluated in lookup table

Cost of box is determined by looking up value in a lookup table. Shipping cost also is determined by looking up value in a lookup table. Use table at cells H23:J28 with a VLOOKUP function to determine cost of a box.

  Write a test program that prompts the user

public static int binaryToDecimal(String binaryString)Write a test program that prompts the user to enter a binary string and displays its decimal equivalent.

  Line of developmental training and inspirational materials

The Becoming Company is a full service provider for a line of developmental training and inspirational materials including videos, music, and books called Drive Change.

  Explain the difference between a fluorescence emission spect

Explain the difference between a fluorescence emission spectrum and a fluorescence excitation spectrum. Which more closely resembles an absorption spectrum?Why do some absorbing compounds fluoresce but others do not?

  Explaining distributed music in physical cds and mp3 files

For some time, popular music has been distributed on physical CDs. It can now be distributed in MP3 files. Explain the nature of the similarity or difference.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd