What happens to all of the old computers

Assignment Help Basic Computer Science
Reference no: EM13845161

Question 3: What Happens to Old Computers?

The personal computer began to become a household fixture in the early 1990s. In the last twenty years, computers have continued to get better and faster year after year. What happens to all of the old computers and electronic devices? Have you ever thrown away a computer or electronic device? How did you dispose of it? Are you aware of any recycling facilities in your area? Are you aware of the harmful effects of computers in landfills?

Question 4: Is Obsolescense Planned?

Many computer users find operating systems are using processor, memory, and storage at such increasing rates that if a person wants to install a new version, they are usually faced with having to replace the computer or pay for hardware upgrades. Some people speculate that software companies plan for this obsolescence to maintain sales and greater profits. Some people blame the hardware companies. Just as you are comfortable using certain hardware and/or software, it becomes obsolete and must be upgraded or replaced. What are your thoughts?

Question 5: Software Plagarism

You have just purchased the newest version of a web authoring software application which costs over $700. Your friend wants to use the same software but can't afford it. He/She asks to borrow your discs to install the software on their computer. After checking the terms of use, you find that it is illegal. What would you do?

Reference no: EM13845161

Questions Cloud

Analyze the relevant facts of the case : Company case- Zipcar: It's Not about Cars- It's about Urban life, As you analyze the relevant facts of the case, alternative courses of action or possible solutions to the problems will come to mind. These alternatives must actually be alternative..
What you understand about the theory rudolf dreikurs : write what you understand about it. you can paraphrase or in your own word. 2 pages with references. The management theorist that I choose is Rudolf Dreikurs or you can choose another theorist I won't have a problem with that.
Self-designed fictitious study : For this assignment, you will undertake an analysis based on a self-designed fictitious study that utilizes statistical methodologies. You will first develop a fictitious problem to examine - it can be anything.
Ease of changes in the processing algorithms : Ease of changes in the processing algorithms: For example, line shifting can be performed on each line as it is read from the input device, on all the lines after they have been read, or on demand when the alphabetization requires a new set of shi..
What happens to all of the old computers : What happens to all of the old computers and electronic devices. Have you ever thrown away a computer or electronic device? How did you dispose of it.
Identify southwest airlines target market proposition : Identify SouthWest Airlines Target Market and Customer Value proposition? Identify South West Airlines Elements of Strategy?
Determining the values : You are given m(x) = kx for all x > 0 and 10P35 = 0.81. calculate 2020q40
What are the complications of having four supply chains : What are the complications of having four supply chains?
Calculate the probability that the electronic equipment : A piece of electronic equipment is built with 3 cooling fans. The equipment will function only if at least 2 of the 3 pans are working. The lifetimes of the fans are subject to forces of mortality that are independent, constant and identical. The ..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Use strong induction to show that every positive

Use strong induction to show that every positive integer n can be written as a sum of distinct powers of two, that is.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  How to motivate the employees to accept the change

You began a group project where you had to rebuild/expand your company's information and communications technology infrastructure and information system.

  Find a better predictor for sequence

Find a better predictor for sequence and perform the DPCM again and find the real tag for the sequence.

  The user to enter the replacement cost of a building

Design a modular program that asks the user to enter the replacement cost of a building and than displays the minimum amount of insurance he or she should but for the property

  Database life cycle

Database Life Cycle

  Identities of peers in the range

I shall create a new question for you to post up your answer so you can earn the points you deserve for helping me out.

  Sums each row in the array and displays the results

A. Write code that sums each row in the array and displays the results.

  Patient care applications

Patient care applications

  Day trader wants to invest a sum of money

Day Trader wants to invest a sum of money that would generate an annually yield of at least $10,000. Two stock groups are available: blue chips and high tech, with average an annual yields of 10% and 25%, respectively

  How easily can your password be hacked

Mystery word Security: How Easily Can Your Password Be Hacked? Questions like as:- What makes a puzzle key powerless or solid? If you need to make a puzzle key that nobody will figure, by what means might you pick one? If you need to figure somebody'..

  Create the data model segment for business rules

The FlyRight Aircraft Maintenance (FRAM) division of FlyRight Company (FRC) does all maintenance for FRC's aircraft. Create the data model segment which reflects the following business rules.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd