User Account

All Pages

Various aspect of coding style

Assignment Help Basic Computer Science
Reference no: EM13880160

1 Explain following various aspects of Coding Style:

A) The  Messy Code Trap

b) Decomposition

c) Readable  Code

d) Variable Names

e) Method Names

f) Class Comments

g) Variable Comments

h) Method Comments

i) Local and Instance Variables

Each explained with exaples

Reference no: EM13880160

Questions Cloud

The financial statements can be found at the company''s : 1.Macy's, Inc. , operates about 810 Macy's department stores and furniture galleries.
Determining the drag force on the plate : Air flows over the top and bottom surfaces of the plate, and measurement of the heat transfer rate is 2000 W. What is the drag force on the plate?
Why is it necessary for a cpa to be prohibited : Why is it necessary for a CPA to be prohibited from having financial or personal connections with a client? Provide an example of how a financial connection to a company would impair an auditor objectivity. Provide an example of how a personal rel..
What do you think kate chopin felt about marriage : Why is she called Mrs. Mallard at the beginning of the story but Louise later on? What is Kate Chopin suggesting? What do you think Kate Chopin felt about marriage? Where in the story do you see evidence of this
Various aspect of coding style : Explain following various aspect of Coding Style :The  Messy Code  Trap ,Decomposition
Compute equivalent units of production for materials : The Smelting Department of Polzin Company has the following production and cost data for September. Compute the equivalent units of production for (1) materials and (2) conversion costs for the month of September. Compute the unit costs for the month..
How should parties decide these issues to mutual advantage : Under an efficient agreement, how should the parties decide the right-to-strike and reserved-work issues?
How should the new bhl product line be configured : How would customers react to a product line reduction? Answering this question required an understanding of how customers value different machines and how much could be saved by rationalising the BHL product lines? Answering this question required..
Describe what is meant by the voltage gain : Questions 1. Describe what is meant by the voltage gain of an amplifier 2, What is the primary purpose of a coupling capacitor ub transistor amplifiers?

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Intro internet communication and development

From the Internet Detective, what factors should you consider when evaluating a web-based source for academic research?What characterizes the stage of internet development following Web 2.0?

  What type of attack was launched on doj?

What type of attack was launched on DOJ?

  Identify the java-based technologies utilized

1. Identify the Java-based technologies utilized in this project and analyze each of them. Then, provide discussion on the purpose of each of the Java-based technologies utilized. 2. Explain why you believe project managers selected these Java-ba..

  How a method named register works appropriately

Th e feature that describes how a method named register() works appropriately and correctly

  What is an advantage of virtualization

What is an advantage of virtualization? List and explain one type of virtualization. What are three of the major data functions performed by a DBMS? Briefly explain the functions. Why are internal threats a major challenge for organizations? How can ..

  How many kegs of nails should low order at one time

Using the EOQ method, how many kegs of nails should Low order at one time? EOQ = square root 2DB/IC.

  Code scheme to meet marketing managers requirements

Design a code scheme that will meet the marketing managers stated requirements.

  Article relevant to current social engineering threats

Select an article relevant to current social engineering threats.

  Internal e-mail getting hacked from the outside

Great Widgets is having a problem with the e-mail server it uses for internal e-mail getting hacked from the outside. One of its network folks has suggested an intranet, but the CEO, T. J. Alexander, is not up to speed about how an intranet wor..

  What problems are encountered when using the internet

Write a 500-word paper that explains what problems are encountered when using the Internet to carry VOIP traffic and what can be done to overcome these problems

  Complete the migration

A few months after you complete the migration you are contacted because one of the employees has had persistent issues logging on to the network and believes that you may have made an error during the migration. You need to check the workstation to v..

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd