Using the sql server diagramming tools

Assignment Help Basic Computer Science
Reference no: EM13718176

Implement a Data Model

For this assignment, you'll implement the data model below in your database, using the SQL Server diagramming tools. Implement the data model EXACTLY as it is shown. The Table names, field names, data types, nullable fields, keys, and relationships all need to be exactly as in the model below.

To hand in the assignment, you will create a Word document, and copy-and-paste the diagram into the word document. You will upload the word document into Entropy to hand in the assignment. I will be able to check your database directly on the server if I need more information.

This data model is meant to capture an initial quote that a company might give a customer. See this sample printed quote. If the customer accepts the quote, then it becomes a sale. Note that addresses are not included - only references to some other table are included (addressIDs). I'll provide the actual diagram with the info via email when I secure a tutor. This is an MIS database management class.  

 

Reference no: EM13718176

Questions Cloud

Constant specific heats-change in specific entropy : Nitrogen gas (N2) undergoes a process from p1 = 10 bar, T1 = 300 K to p2 = 12 bar, T2 = 1000 K. Assuming ideal gas behaviour, determine the change in specific entropy, in kJ/(kg K), assuming:
Differences and similarities between windows 7and windows 8. : Complete steps that cover the differences and similarities between Windows 7and Windows 8.1. In your APA formatted Paper answer the questions below.1. Discuss three differences and three similarities in the configuration of a Windows 7 for a h..
Estimate the work done by the gas on the bullet : A 110-g bullet is fired from a rifle having a barrel 0.594 m long. Choose the origin to be at the location where the bullet begins to move. Determine the work done by the gas on the bullet
Determine the thermal efficiency of the cycle : A steam power plant operates on a simple Rankine Cycle between the pressure limits of 10MPa and 50kPa. The mass flow rate of the steam is 50kg/s. The quality of the steam at the turbine exit is 90%.
Using the sql server diagramming tools : Implement the data model below in your database, using the SQL Server diagramming tools. Implement the data model EXACTLY as it is shown. The Table names, field names, data types, nullable fields, keys, and relationships all need to be exactly ..
How long did it take to reach the maximum height : A volleyball player throws a ball straight up from 1.5 m off the ground (so x=1.5m at t=0s) and catches it 1.4 seconds later. How long did it take to reach the maximum height
Determine the power input to this compressor : Air is compressed from 100 kPa and 20C to 700 kPa in an adiabatic compressor with an isentropic efficiency of 90%. Assuming that the mass flow rate is 0.1 kg/s determine the power input to this compressor, in kW, and the rate of entropy generated. Us..
Find how many meters does it travel before stopping : The driver of a 1720kg car traveling on a horizontal road at 102km/h suddenly applies the brakes. How many meters does it travel before stopping under these conditions
Power cycle operates between two reservoirs : A power cycle operates between two reservoirs having temperature 700 K and 300K, respectively. QH is the heat (thermal energy) received from the hot reservoir. QL is the heat rejected to the cool reservoir. Wmech represents the mechanical work produc..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Research and discuss applications in a specific device

Discuss further thoughts on the importance of path finding to devices like GPSs. Conduct some research and discuss applications in a specific device

  What are local and global variables

What are local and Global variables? And how many input variables can a MATLAB function have ?

  Develop the new project plan using microsoft project

Develop the new project plan using Microsoft Project for two-day training session in which people are brought in from different parts of country.

  Generate dropdown to create example c++ code

Submit your C++ source code that you generated from RAPTOR with comments added to each line or where necessary to explain program flow. Also submit the RAPTOR file (flowchart) of your working program.

  Implement new forms of computer-mediated technology

How would implementing new forms of computer-mediated technology influence your organization's communication? What is the significane of managers selecting suitable channel for message distribution in Information Age?

  Social policy and debate regarding children and technology

See Supreme Court Rules for more information. If Winner's three guiding maxims were utilized, how would this influence social policy and debate regarding children and technology?

  What is the value of v_flag

What is the value of v_flag when the following PL/SQL block is executed successfully?

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Websites be required to adhere to section standards

what is the purpose then? Do you think that all websites should be required to adhere to Section 508 standards? Why or why not?

  Compare and contrast monitoring of patient vital signs by

mobile computing has dramatically changed how information is accessed and shared. wireless networking has been an

  Describe of what the computer considers true or false

For your initial post, provide your own description of what the computer considers "TRUE" and what the computer considers "FALSE." Then, provide at least two code examples (original examples) that would return TRUE

  What is the const keyword in c++ and why would you use

What is the const keyword in C++? Why would you use the const keyword

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd