Three forms of database connectivity methods

Assignment Help Basic Computer Science
Reference no: EM13724295

Question: database solutions today must be able to adapt and integrate among various computing applications. Determine at least three forms of database connectivity methods that can be used as an interface between applications. For each method you have chosen, create an example that demonstrates how each could facilitate data exchange functionality in a cloud service environment. Answer in 200 - 400 words. Use a diagram to explain.

Reference no: EM13724295

Questions Cloud

Finding the required interest rate : Your parents will retire in 30 years. They currently have $260,000, and they think they will need $1,500,000 at retirement. What annual interest rate must they earn to reach their goal, assuming they don't save any additional funds? Round your answer..
Discuss the pros and cons of two information security : Discuss the pros and cons of two information security management models that would be appropriate for ChoicePoint to implement.
What will be your annual loan payments : You need $19,000 to purchase a used car. Your wealthy uncle is willing to lend you the money as an amortized loan. He would like you to make annual payments for 5 years, with the first payment to be made one year from today. He requires a 9% annual r..
What is the present value of this security : You own a security that provides an annual dividend of $135 forever. The security’s annual return is 5%. What is the present value of this security? Round your answer to the nearest cent.
Three forms of database connectivity methods : Question: database solutions today must be able to adapt and integrate among various computing applications. Determine at least three forms of database connectivity methods that can be used as an interface between applications.
Current liability-long term liability-owners equity account : Classify the following accounts by listing whether they are a current asset, property plant and equipment, current liability, long term liability or owners equity account:
Demand for housing is often described being highly cyclical : The demand for housing is often described as being highly cyclical and very sensitive to housing prices and interest rates. Given these characteristics, describe the effect of each of the following in terms of whether it would increase or decrease th..
Leverage can be the least expensive form of capital : It is noted that initially, leverage can be the least expensive form of capital. However, if potential lenders feel a firm is overly leveraged, they may charge a punitive rate, or refuse to lend all together. This can be disastrous if a firm needs to..
Not believing in absolutes in an absolute : Not believing in absolutes in an absolute. There is really only one ethical system. Moral relativism essentially states that there are no moral absolutes. Conflicting absolutism states that moral conflicts do not exist because God cannot contradict h..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Write a program that computes terms of the fibonacci series

Write a program that computes terms of the Fibonacci series, defined as: 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, ... Each term in the series is the sum of the preceeding two terms.

  Find the value of (((a+b+)+c)+d)

find the value of (((a+b+)+c)+d) that would be computed in a floating point number system that has a mantissa approximately equivalent in precisions to 17 decimal digits. a = 99.0, b = 1.0*10^30, c=1.0*10^30, d = -98.0

  1/(2n) is less than or equal to [ 1 * 3 * 5 *...* (2n - 1)]

Prove that 1/(2n) is less than or equal to [ 1 * 3 * 5 *...* (2n - 1)] / (2 * 4 *...* 2n) whenever n is a positive integer.

  A word document containing all of the identified methods

A word document containing all of the identified methods for the "Zoo Organizer"

  Create an applet to draw a digit using the method fillrect

In Java Programming, Create an applet to draw a digit using the method fillRect of the class Graphics. For instance, if the input is 4, the applet will display the digit 4. I will also need the HTML code along with the code

  Both lagrange interpolation and newton''s interpolation

Use both Lagrange interpolation and Newton's interpolation formulae to find the polynomials for the

  Functions of the universitys library electronic database

Develop a unit test plan for key functions of the university's library electronic database.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  What are the advantages of using variables in a data type

A data type describes the format and size of a data item. However, it does not define the type of operation a data item needs to perform. Do you agree with this statement

  Explaining options to begin troubleshooting

Which two options should you use to begin troubleshooting?

  Create your own function that accepts one input parameter

Using Pseudocode, create your own function that accepts one input parameter and returns a float number. You decide the theme.

  Propose three to five additional activities

Propose three to five additional activities you think should be added to a Gantt chart to help you estimate resources and durations. Write a one-page paper describing these new activities.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd