The vendor about the increased storage

Assignment Help Basic Computer Science
Reference no: EM13887656

A company that has engaged in a business that requires fast response times has just recieved a bid for a new system that includes much more storage thatn was specified in the requirements document. When the company questioned the vendor about the increased storage, the vendor said he was bidding a set of the smallest capacity disk drives that the company makes. Why didn't the vendor just bid fewer disks? 

Reference no: EM13887656

Questions Cloud

Wave function changes phase : Solve  for  the  exact   t111 (t),  usi ng  Equation  9.82,  and  show  that   the  wave function  changes  phase, bu t  no  transitions  occur.  Find  the  phase  change, (T) , in  tenns of  the function Vo(t).
Compute ms queens agi : Ms. Queen, age 21, is a full-time college student with an athletic scholarship that provides the following annual benefits: Tuition payment ...$12,800 Fees and books ...3,500 Room and board ...10,000 Ms. Queen works in the athletic department as a tr..
What is gdp : What is GDP? Suppose consumption increases by 10% but output only rises by 5%. Invest- ment and government spending both increase by 3%. What happens to the gap between ex- ports and imports?
Spontaneous emission dominates for frequencies : Show that at room temperature ( T = 300 K) thermal stimulation dominates for frequencies well below 5 x 1012 Hz, whereas spontaneous emission dominates for frequencies well above 5 x 1012 Hz. Which mechanism dominates for visible  light?
The vendor about the increased storage : A company that has engaged in a business that requires fast response times has just recieved a bid for a new system that includes much more storage thatn was specified in the requirements document. When the company questioned the vendor about the inc..
What is value added in each sector : Consider an economy with three productive sectors: mining and farming; manufactur- ing; and retailing. Manufacturers produce goods each year with a sale value of 500. They sell 400 to retailers and 100 direct to the private sector and to governmen..
Determine the extent to which she can deduct each payment : Mrs. Carr made the following interest payments. Determine the extent to which she can deduct each payment. a. $21,000 on a $280,000 mortgage incurred to construct (and secured by) her personal residence. b. $3,000 on a $34,000 second mortgage secured..
Table shows pairs of transaction latency and processing rate : Assume a quad-core computer system can process database queries at a steady state rate of requests per second. Also assume that each transaction takes, on average, a fixed amount of time to process. The following table shows pairs of transaction late..
What about the activities of the police force : How would you treat the activities of criminals in GDP accounting? What about the activities of the police force?

Reviews

Write a Review

Basic Computer Science Questions & Answers

  What is the decimal equivalent of 5fh

Address 400H contains the byte 5FH. What is the decimal equivalent of 5FH

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  The success of 24-bit digital audio technologies

3. A company noting the success of 24-bit digital audio technologies compared to earlier 16-bit digital audio technologies has decided to work on developing a 28-bit digital audio technology. a. Describe the type of signal conversion being utilized a..

  Evaluation at astro bank and the balanced scorecard

IS/IT project managers use evaluation processes to determine the success of a project. This kind of evaluation is not always a straightforward task. In this Discussion, you will determine evaluation criteria in an example project from a case study..

  How "direction" can be used in an effective publication?

What are four examples of how "direction" can be used in an effective publication?

  Why does the label control that contains your name print

why does the label control that contains your name print above the page number?

  Design a combinational circuit

Design a combinational circuit that accepts a 4-bit number and output a 3-bit binary number that approximates the square root of the number

  Discuss what is and how the auto discovery feature of simple

Discuss what is and how the auto-discovery feature of Simple Network Management Protocol (SNMP) operates? Give a real-world scenario where this technology would be an appropriate fit (or not)?

  Write a recursive function called add_digits

Write a recursive function called ‘add_digits’ that takes an integer as a parameter and adds its digits. For example, if we call this function with the parameter n=1234, the returned value is 1+2+3+4=10.

  What are the differences between file viruses

1. What are the differences between file viruses, boot viruses, macro viruses, and network viruses?

  Convert decimal mumbers into bit binary number

Convert the following decimal mumbers into 8-bit binary numbers a required for 2's complement math, and perform the indicated operations.

  Implement the class with accessors and mutators

Implement the class with accessors and mutators for the movie name and MPAA rating. Write a method addRating that takes an integer as an input parameter.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd