Sort the array and write out the sorted array

Assignment Help Basic Computer Science
Reference no: EM13230653

I'm not really sure how to answer the question below. There are two parts. Any help would be appreciated.
Question:
Consider a program that will read employee information into an array of objects, sort the array by employee identification number, write out the sorted array, and compute various statistics on the data, such as the average age of an employee.

A) Write complete specifications for this problem and design a modular solution. What classes and methods did you identify during the design of your solution?

B) Write specifications, including preconditions and post-conditions, for each method. Write specifications for a function that advances any given date by one day.

 

Reference no: EM13230653

Questions Cloud

Efficiency challenges at the cafe and harm the business : From the scenarios, Chris and Erica are faced with efficiency challenges at the café. Explain how these challenges could potentially harm the business, and suggest a brief plan to improve on efficiency and customer satisfaction.
Create a japplet that contains a jlabel and jbutton. : Create a JApplet that contains a JLabel and JButton. You'll create a JButton that will automatically change font typeface, style, and size when clicked by the user. Change the font typeface, style, and size on the JLabel.
Compute the percentage of carbon in the sample : 2121g sample of an organic compound was burned in a stream of oxygen adn the CO2 produced was collected in a solution of barium hydroxide. Calculate the percentage of carbon in the sample if .6006 g of BaCO3 was formed
Explain the metabolic : Name at least four metabolically signifant membrane bound cellular compartments and the metabolic pathways that take place with each compartment
Sort the array and write out the sorted array : Consider a program that will read employee information into an array of objects, sort the array by employee identification number, write out the sorted array, and compute various statistics on the data, such as the average age of an employee.
What is the simple rate of return on the machine : The machine is being depreciated using the straight line method, based on its useful life. It has a payback period of four years. What Is the simple rate of return on the machine?
What should a short-term or long-term consequence : What should a short-term or long-term consequence make a difference in resolving an ethical dilemma?
Rosen argues that hostile environment sexual harassment : Rosen argues that hostile environment sexual harassment should be prosecuted as a violation of the right to privacy rather than discrimination.
Aspect of consumer buying behaviour theory : Choose an aspect of consumer buying behaviour theory from the list below. Carry out a critical investigation of how it can be used advantageously in the marketing of a product/service/brand* of your choice.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  File format would you choose

What file format would you choose for the following tasks: 1. A cartoon strip 2. A 3D model for use on a multimedia presentation on the web

  Write a statement that passes the value 4

1) Examine the following function header, the write an example call to the function. void showValue(int quantity)

  Design a ram chip

Design a RAM chip that is 128K x 8. For each sub-part below, show the array of RAM cells and its dimensions, the decoder(s) required to access the array, and tabulate the numbers of gates required to implement the decoding.

  What would be the ieee 754 single precision binary represent

What would be the IEEE 754 single precision binary representation of the floating point value -314159265.3589? Express your final answer as an 8-hexdigit number and explain how your answer was obtained for full credit

  Derive expression for the effective mips rate

Derive an expression for the effective MIPS rate when using this system for the execution of this program in terms of x, n and α.

  Some time on a new parallel computer

You are given some time on a new parallel computer. You run a program which parallelizes perfectly during certain phases, but which must run serially during others.

  Allow different payment and shipping options

allow different payment and shipping options. There are a plenty of examples of this kind of web sites. Some well-known ones are amazon.com, Barnes & Nobles, and Borders.

  Draw the block diagram for the hardware

Draw the block diagram for the hardware that implements the following: y + xz: AR ß BR + CR where AR, BR and CR are n-bit registers and x, y, and z are control variables.

  Write a sample program that asks for the center

Write a sample program that asks for the center and side length, then prints out the square (using the toString method that you inherit from Rectangle) and the area of the square.

  Write a program to prompt the user to enter a postfix expres

Write a program to prompt the user to enter a postfix expression. When the user presses enter, the stack based method for constructing expression trees will be executed

  Create a rational number class

Create a Rational Number class. A Rational number has 2 parts, an integer numerator and an integer denominator. Add two constructors (negative denominators must be moved to the numerator), getters, setters, a print method, and an input method.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd