User Account

All Pages

Research and discuss applications in a specific device

Assignment Help Basic Computer Science
Reference no: EM13285592

What does a dash mounted car GPS do? It gives us directions from point A to point B, adapts our location on that path and then redirects based on the roads.

This all happens thanks to path finding. All roads are branches to trees, and the intersections are nodes. The speed limits and number of lanes are information about the branch.

Discuss further thoughts on the importance of path finding to devices like GPSs. Conduct some research and discuss applications in a specific device

Reference no: EM13285592

Questions Cloud

Essay exploring the medieval, renaissance reformation : Write a thesis based essay exploring the medieval, renaissance reformation images of women and how it affects the women there after
Create weighted scoring model to determine grades : Create a weighted scoring model to determine grades for a course. Final grades are based on three exams worth 20 percent, 15 percent, and 25 percent, respectively; homework is worth 15 percent; and a group project is worth 25 percent. Enter scores fo..
The game tic-tac-toe : For your first assignment, download the linked file below. This is a .cpp file of the game Tic-Tac-Toe. Unzip the file, and run the game. Play a few games and begin to analyze the artificial intelligence that is currently programmed. Then, rev..
Discuss related security issues and ethical issues : Discuss related security issues and ethical issues, such as informed consent and confidentiality. Include your opinion of the advantages and disadvantages of online therapy services.
Research and discuss applications in a specific device : Discuss further thoughts on the importance of path finding to devices like GPSs. Conduct some research and discuss applications in a specific device
Jail administrator implementing a new suicide watch program : What if you were a jail administrator implementing a new suicide watch program? What preventative methods would you be sure to include in your new program and why?
Use a two-stage transposition technique to encrypt : Use a two-stage transposition technique to encrypt the following message using the key "Decrypt". Ignore the comma and the period in the message
What if you were the sheriff of a local jail : What if you were the sheriff of a local jail? In addition to meeting the minimum program requirements, explain which program you think would be the most important one to implement in your jail and why?
Deveopment of heath care policies-explain the connection : Which type of managed care organization do you feel is the best for the general population?Why? The overall health of the popuation has a direct impact on the deveopment of heath care policies-explain the connection.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Keyboard combinations that can increase

Microsoft® Word provides keyboard combinations that can increase a user's efficiency. How can these shortcuts simplify the support process for Microsoft® Word

  How do you think that freedom of expression impact

How do you think that Freedom of expression impact

  Ipo chart and pseudocode

Start by analyzing the problem; use an IPO chart and pseudocode (or flowchart) to brainstorm the logic prior to start coding. Using Visual Studio code and test your program according to your pseudocode solution. Once you are satisfied with your progr..

  Draw a possible class diagram,uml diagram for the system

Ship A has two instruments, which provide digital information for navigation: (1) A global positioning system (GPS) measures the position and velocity of Ship A.

  What are some domains in which they can be used

What are some domains in which they can be used? Justify your answers with examples and reasoning.

  Display a graphical representation of the binary search tree

The program should display a graphical representation of the binary search tree. Show all the leaf nodes; Show all the nodes in PreOrder, InOrder and PostOrder traversals.

  How many units of each component ordered from each supplier

If the Edwards production plan for the next period includes 1000 units of component 1 and 800 units of component 2, how many units of each component (C1, C2) should be ordered from each supplier (S1, S2, S3)?

  Distinguish web pages or web servers use for task

Suppose the role of the IT consultant to new nonprofit organization, Free Flu, to provides flu shots to the elderly. The organization requires the domain name. Distinguish between any Web pages or Web servers you would use for task.

  Finding vertices of polygon stored in array-clockwise order

Assume that n ≥ 3 and the n vertices of P are stored in an array in clockwise order around P. Describe how to determine efficiently whether exactly one of the points q and r falls within P. Analyze the time for your algorithm.

  Compute the cost of sorting the relation in seconds

Suppose a flash storage device is used instead of disk, and it has a seek time of 1 microsecond and a transfer rate of 40 MB per second. Recompute the cost of sorting the relation in seconds with.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  An iterative algorithm to traverse an arbitrary number

An iterative algorithm to traverse an arbitrary number of nested subdirectories in a file system.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd