Project in designated area of coastal zone is significant

Assignment Help Basic Computer Science
Reference no: EM1384951

Have you contacted State Historic Preservation Office (SHPO) to see if the project is in designated area of coastal zone which is significant to the study, understanding, or illustration of national, state, or local history or prehistory, comprising natural processes? (b) If project is in the area designated under (a) of this section, how will you comply with applicable requirements in statutes and regulations listed in (b)?

Reference no: EM1384951

Questions Cloud

What is the angular velocity after collision : A uniform spherical shell of mass 8.60kg with diameter 48 cm has four small masses of mass 2.00kg attached to its outer surface and equally spaced around it. This combination is spinning about an axis running through the center of the sphere and t..
Social status-interaction and success : Someone at work made a statement to me and I did not know how to respond to it. Could someone please elaborate on this statement a little more?
Illustrate what is her breakeven point : Marcy owns Caps for Kids and sells her hand knitted caps for $20. The variable cost per hat created is $10 and fixed costs are $10,000. Illustrate what is her breakeven point?
Service of compound-grade freeway segment : There are no interchanges in the vicinity of this freeway segment. If the peak-hour factor is .90 and all of the drivers are regular users, what is the level of the service of this compound-grade freeway segment?
Project in designated area of coastal zone is significant : Have you contacted State Historic Preservation Office (SHPO) to see if the project is in designated area of coastal zone which is significant to the study, understanding, or illustration of national, state.
Find carbon atoms in the page : To obtain a better feeling for atomic dimensions, suppose that the page on which this question is printed is made entirely of the polysaccharide cellulose,
What communication concepts or theories relationship : What communication concepts or theories could be used to enhance communications through personal selling, sales promotion, or relationship marketing?
Population-ecology model : Recognize three writers/researchers who are associated with Population-Ecology model describing their contributions. Then relate this model (benefits and/or problems) to one real-work experience of your own.
External influences of the market : they are constantly changing and adapting to current conditions, political trends and external influences of the market. Have you encountered or read about any current financial issues which should perhaps be addressed by the GAAP standard setting..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Compare activity of disk required for each of the relational

Compare the activity (quite theoretical) of the disk (in number of bytes) required for each of both relational. Indicate the advantages and the inconveniences of the new relational scheme.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Explaining cash-drawer management concept

Explain in scholarly detail cash-drawer management concept and its relationship to departmental Budget vs. Actual control process.

  State of six conditional flags after instructions executes

Forecast the state of six 8086 conditional flags after each of instructions which are given below executes. MOV AL,AH b. ADD BL,CL c. ADD CL,DH d. OR CX,BX

  Explain applications of pervasive computing

Which of the applications of pervasive computing do you believe are probable to gain greatest market acceptance over next few years? Why?

  Create seven-bit adder in logicworks

Create 7-bit adder. Inputs are X[6..0], Y[6..0], and Cin. Outputs are S[6..0] = X[6..0] + Y[6..0] + Cin, where + is arithmetic addition. Implement adder in LogicWorks. The parts you can use include.

  Deliver software to a schedule

You are asked by your manager to deliver software to a schedule that you know can only be met by asking your project team to work unpaid overtime.

  Research various types of hard drives available from online

Research the various types of hard drives available from online and/or local retail computer stores.Make a chart of several different brands or models of 1 TB desktop hard drives.

  Largest positive octal number that can be stored in pdp-9

Data was stored in the PDP-9 computer using six-digit octal notation. Negative numbers were stored in 8's complement form. What is the largest positive octal number that can be stored in this machine?

  Explain how has science enhanced quality of life

Explain typical day in your life from time you wake up, until time you go to bed. Explain how science influences you and your routine throughout the day.

  Turing machine that decreases positive binary number by one

Write a Turing machine that decreases a positive binary number by one? By writing turing machine an instruction set in the form of (w,x,y,z,a) where w is current state,

  Recognize components of system cpu

Recognize the following components of your system: type of central processing unit (CPU), amounts of random access memory (RAM) and read-only memory (ROM), input and output devices, and types of storage.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd