How would you specify this protection scheme in unix

Assignment Help Basic Computer Science
Reference no: EM13900282

Assignment Preparation

Activities include independent student reading and research.

Assignment

Choose one of the following options:

Option 1: Write a 1- to 2-page paper that discusses the following scenario: Consider a system that supports 5,000 users. Suppose you want to allow 4,990 of those users to be able to access one file. How would you specify this protection scheme in UNIX®?

Option 2: Write a 1- to 2-page paper that discusses the following scenario: Consider a system that supports 5,000 users. Suppose that you want to allow 4,990 of those users to be able to access one file. Suggest another protection scheme that can be used more effectively for this purpose than the scheme provided by UNIX®?

Option 3: Write a 1- to 2-page paper that discusses the following scenario: Some systems keep track of the types of a file, others leave it to the user, and yet others simply do not implement multiple file types. Which system is better?

Reference no: EM13900282

Questions Cloud

Review standard costs - wake up and smell the coffee : Review the Standard costs: wake up and smell the coffee. article. When evaluating performance, many organizations compare current results with the actual results of previous accounting periods. Is an organization that follows this approach likely ..
How outcome of hypothesis test and confidence interval : Are the data sufficient to conclude that children with a history of childcare show significantly more behavioral problems than the average kindergarten child? Use a one-tailed test with a = .01.
Federal strategic plan to prevent and end homelessness : What does this statement mean? What is the "Federal Strategic Plan to Prevent and End Homelessness in 2010"? and is this plan working?
Determine the book value of the two fixed assets on december : Record the adjusting journal entry on December 31 to record the depreciation expense for the two fixed assets. Determine the book value of the two fixed assets on December 31.
How would you specify this protection scheme in unix : Option 1: Write a 1- to 2-page paper that discusses the following scenario: Consider a system that supports 5,000 users. Suppose you want to allow 4,990 of those users to be able to access one file. How would you specify this protection scheme in UNI..
In gymnastics or diving competition : In gymnastics or diving competition,each contestant's score is calculated by dropping the lowest and higher scores and then adding the remaining scores. Write a complete C++ program that allows the user to enter eight judges' scores and output the to..
Respond to given discussion : Respond to discussion- Respond in one or more of the following ways: Ask a probing question. Share an insight from having read your colleague's posting. Offer and support an opinion. Validate an idea with your own experience
What can we learn about the microsociology of japan : What can we learn about the microsociology of Japan from this story?
Application uses both warehouse and operational data : Field sales people can have a sales database on their smart phones. The sales database contains sensitive, competitive information. Using their smart phones, the salespeople can query the data, update it, delete it, and place orders. This application..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Why did you choose this way versus alternative ways

Section Number is an integer (such as 1 or 2) that distringuishes one section from another for the same course but does not uniquely identify a section. How did you model SECTION? Why did you choose this way versus alternative ways to model SECTIO..

  Use the mvc design pattern to create a gui program

Use the MVC design pattern to create a GUI program for Triangle objects. Include a form for users to enter values for a triangle;s three sides and a button that when clicked, displays data from the Triangle object created from the input.

  The use of an external service provider for data storage

Prepare a 6-10 slide narrated PowerPoint presentation that identifies the possible risks to an organization in each of the following outsourcing situations: The use of an external service provider for your data storage.

  What type information is carried by data bus and address bus

What type of information is carried by the Data Bus? The Address Bus?

  What are the primary components

What are the primary components that comprise an Oracle relational database management system? Identify at least 1 Bible verse that explains how we should facilitate relationships with each other. Expound upon this importance.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  How value parameters useful in processing data in a program

Discuss some useful applications for n-dimensional arrays, such as graphical 3-D or biotechnology applications.

  Identify and research three different commercial it security

Security being a top concern for any organisation, choosing the correct security solutions is of utmost importance. Consider an area of information technology (IT) security, such as, network security, e-mail security, database security and so on. Ide..

  Writing a program in java about assigning integer values

Write a program to assign the integer values 1 through 25 to a 25-element integer array. Then, print the array as five separate lines, each containing five elements separated by commas.

  Case study - casey anthony trial

Determine whether the software issue, which caused inaccurate evidence in the trial, would've affected your perception of the prosecution's case if you were a juror in this trial.

  Explaining major provisions of telecommunications act

Write down some of the major provisions of the Telecommunications Act of 1996?

  Create an account class

Create an account class with following given UML Diagram:  UML DIAGRAM Account Class:

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd