Explain how self-arp might help with this problem

Assignment Help Basic Computer Science
Reference no: EM131045979

Suppose hosts A and B have been assigned the same IP address on the same Ethernet, on which ARP is used. B starts up after A. What will happen to A's existing connections? Explain how "self-ARP" (querying the network on startup for one's own IP address) might help with this problem.

Reference no: EM131045979

Questions Cloud

Ip currently uses 32-bit addresses : If we could redesign IP to use the 6-byte MAC address instead of the 32-bit address, would we be able to eliminate the need for ARP? Explain why or why not.
Why is being a foster parent a difficult role : What other professionals are involved in a child abuse intervention process? What are some ways of preparing children if they have to testify in Court that minimizes trauma? What are some goals in treating physically abusive family?
Assume that dinah draws a check on oxford bank : Assume that Dinah draws a check on Oxford Bank, payable to the order of Pam; that Pam indorses it to Amy; that Amy deposits it to her account in Houston Bank; that Houston Bank presents it to Oxford Bank, the drawe
Average inventory carrying-holding cost : 1. What is the average inventory carrying/holding cost for the brakes? 2. What is the EOQ for the brakes? 3. What is the ROP for the brakes?
Explain how self-arp might help with this problem : Explain how "self-ARP" (querying the network on startup for one's own IP address) might help with this problem.
Tom jones owed bank of cleveland : Tom Jones owed Bank of Cleveland $10,000 on a note due November 17, with 1 percent interest due the bank for each day delinquent in payment. Jones issued a $10,000 check to Bank of Cleveland and deposited it in the night vault the evening of Novem..
Sketch an improved version : Suppose we simply drop P, after sending out a query, when cache lookup fails. How would this behave? (Some early ARP implementations allegedly did this.)
Explain short-run and long-run effects : Explain short-run and long-run effects on the US GDP and the price level for the following events. Assume that policymakers take no action.
Result of the recessionary gap : Suppose the government aims to stimulate the economy as the result of the recessionary gap. Explain which macroeconomic policy action you would recommend. Give both the direction and the magnitude of your policy action.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Issues information technology

Locate a news article based on a recent event on ethical issues related to information technology. For example, Wikileaks, Snowden, etc...

  Legal and ethical issues including scope of liability

It is to be word-processed; 12pt font, single line spacing, and fully referenced (APA). All pages are to have Headers and/or Footers with your Name and Student ID number and Page Number.

  Create method return the number of positive numbers in array

Consider an array of integers as below: int[] a = {5, 2, -4, 3, 0, -5, 7, 11, 6, 13} a. Complete the method named count(int[] a) in the class Count.

  How much time elapses when the client clicks on the link

How much time elapses from when the client clicks on the link until the client receives both the Web page and the two images?

  Submit the flowchart of your working program.

Also submit the flowchart of your working program. Make sure you run it to make sure it is error free and does what it is supposed to.

  What is an unbreakable uml diagram

What is an "unbreakable" UML diagram and can you give the definition and an example would be awesome.

  Sql perform the requested tasks

SQL perform the requested tasks

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  The k-nearest neighbour and naïve bayes algorithms

In this assignment you will implement the K-Nearest Neighbour and Naïve Bayes algorithms and evaluate them on a real dataset using the stratified cross validation method.

  Web about toutorial for cooking saudi food

Will develop a web about toutorial for cooking Saudi food , and have a hard time writing a planing project for my topic. Follow these link in order to complete the assignment Her is the requirements for the assignment This assignment has two part..

  Baking in the vertex colors

Render the sphere in Part I by baking in the vertex colors, for every vertex calculate its vertex normal by averaging the face normals. Normalize it and then pass the normalized value as a Hue Saturation and Lightness color value i.e. x -> H y-..

  Write a function to simulate the game show problem

Write a function to simulate the game show problem. Your function should randomly select locations for the prizes, select a door at random chosen by the contestant, and then determine whether the contestant would win or lose by sticking with the o..

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd