Discuss the costs and support considerations of the web

Assignment Help Basic Computer Science
Reference no: EM13215243

Course Outcomes:
IT530-1: Analyze the business impact of data communications and networking technology.

Assignment Instructions:

1. Web servers (and browsers) are one of the most familiar and commonly used network applications. Research and compare two Web server technologies of your choice (such as Apache® or WeblogicTM, for example) and discuss their differing functionalities, cost of deployment, general rate of adoption by businesses and other pertinent points. Which Web server software is most commonly used? Why? Would you be more likely to adopt an open source Web server application? Or not? What would be the advantages or disadvantages of using an open source Web server application?

2. Based on your research, write a 6-8 page paper that researches the use, adoption, and implementations of two different Web server technologies. The paper should also discuss the costs and support considerations of the Web server applications.

Preparing Your Assignment:

The written essay/paragraph formatted paper should be 6-8 pages long NOT including cover page and references. As you research various access technologies, ALL of the pages must have citations and references. No more than one direct quotation (of 40 words or more) is allowed per page and bullet lists without substantial narrative included are strongly discouraged. There should be no spelling or grammar errors. All written Assignments should be in APA format. APA formatted in-text citations and references are required for all sources, and all figures and tables must be captioned in APA format. If you are unfamiliar with APA formatting, please see the Kaplan Writing Center for more information on how to work with APA.

Directions for Submitting Your Assignment:

Assignment Grading Rubric

Course: IT530 Unit: 2 Points: 90
Copyright Kaplan University
Compose your Assignment in a Microsoft Word document and save it as Username-IT530 Assignment -Unit#.doc (Example: TAllen- IT530 Assignment-Unit2.doc). Submit your file by selecting the Unit 2: Assignment Dropbox by the end of Unit 2.

Assignment Requirements:

All papers must meet these standard requirements:
Paper follows APA formatting
Length is 6-8 pages long, not including references and cover page

No more than three bulleted or listed points per paper.
No more than one direct quote per page from a reference source and those quotes must be properly cited within the body and in the references at the end of the paper.
Title page
Reference

Reference no: EM13215243

Questions Cloud

Examine and analyze the principles of inheritance : Examine and analyze the principles of inheritance. Use the Library to get started on finding resources.
Suggest a change to the closest-pair algorithm : Suggest a change to the closest-pair algorithm that avoids presorting the Y array but leaves the running time as O(n lg n). (Hint: Merge sorted arrays YL and YR to form the sorted array Y .)
Explain after-tax rate of return on assets before retirement : Tara, age 44, plans to retire at age 67. Her life expectancy, accounting for family medical history, is age 97. Tara is single and currently earns $56,000 per year as a university librarian.
Evaluate the technology, connectivity : Your company has assigned you the task of evaluating its computer networks. You are to write a memo covering 15 points on which you will evaluate the technology, connectivity, and functioning of the company's computer networks.
Discuss the costs and support considerations of the web : Based on your research, write a 6-8 page paper that researches the use, adoption, and implementations of two different Web server technologies. The paper should also discuss the costs and support considerations of the Web server applications.
Change tactics-change policy and change strategy : How did airplanes change the face of warefare, change tactics, change policy, and change strategy?
Order to maximize expected revenue : The discount fare price is $200 and the estimated "denied boarding" cost is $500. How many seats should the airline sell for this flight in order to maximize expected revenue?
What is this maximum revenue next month : What price maximizes JJ's revenue, and what is this maximum revenue and what price maximizes revenue, and what is this maximum revenue next month?
Explain outcome requires the lowest monthly contribution : As their financial planner, provide some assistance with these calculations. The two primary options are listed below. Considering all previous information, which outcome requires the lowest monthly (end-of-month) contribution if they also require..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  What does it mean to spawn a process?

Process can be in different states to allocate the resources better. List the symbol and meaning for each of these states. 2. What does it mean to spawn a process?

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Describe the conceptual model of a two-dimensional array

Describe the conceptual model of a two-dimensional array. Include in your explanation how a two-dimensional array might be used, why these arrays are similar to tables, and how to declare and initialize a two-dimensional array.

  Suppose you observe that your home pc

Suppose you observe that your home PC is responding very slowly to information requests from the net. And then you further observe that your network gateway shows high levels of network activity

  Deterministic context free and context free grammar

Classify the languages given below as a) deterministic context free, b) context free but not deterministic, c) not context free. Give explanantion.

  The program must use a loop

The program MUST use a loop to read in the series of integers from the user. The output is then displayed after the loop. Algorithm   or Pseudo Code  (as an outline): At the beginning or end or your program write the algorithm or pseudo code as a mul..

  Find the sum of the elements of an array called list1

Write a program to find the sum of the elements of an array called list1. The size of list1 is four bytes. The values of list1 are $FF, $1, $FE, and $02. To check your work, the sum should become $0200.

  Which of the following are advantages of the osi model

The OSI model was designed to provide a framework for networking and internetworking standards. Which of the following are advantages of the OSI model? There are 4 correct answers.

  Explain components of information systems

Using the three components of information systems and the complementary assets concepts, discuss why some companies achieve better results with information systems than others.

  Tcp procedure for estimating rtt

Let the TCP procedure for evaluating RTT. Assume that α = 0:5. Let SampleRTT1 be the Most recent sample RTT, let SampleRTT2 be the next most recent sample.

  Explain one technological device

Explain one technological device in 350 to 700 words. Include the following:When did it come (or will it potentially come) into existence? What scientific or technological reasoning explains how this potential will be (or can be) be reached in t..

  Express the angle with respect to the tangential velocity

Express the angle with respect to the tangential velocity vector (ie, +90° points radially out). (Points : 5) A) 10.9 m/s2 at -75° B) 10.9 m/s2 at +75° C) 37.9 m/s2 at -75° D) 37.9 m/s2 at +75°

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd