Determines the total due including sales tax and shipping

Assignment Help Basic Computer Science
Reference no: EM13703191

Create an application that determines the total due including sales tax and shipping. Allow the user to input any number of item prices. Sales tax of 7.75% is charged against the total purchases. Shipping charges can be determined based on the number of items purchased. Use the following chart to determine the shipping charge. Display an itemized summary containing the total purchase charge, number of items purchased, sales tax amount, shipping charge, and grand total.
fewer than 3 items $3.50
3 to 6 items $5.00
7 to 10 items $7.00
11 to 15 items $9.00
more than 15 items $10.00

Reference no: EM13703191

Questions Cloud

Calculate the pressure gradient due to gravity in water : A submarine can safely resist 1800 psig. How deep in the ocean can the submarine travel? I found the answer to be 1205 m. Hope fully this is correct. The follow up question is. Calculate the pressure gradient due to gravity in water at 15 C. Express ..
Write a function takes two int arguments : Write a function takes two int arguments (raise AssertionError if the first is > the second); it returns a function that takes an int as an argument and returns a bool indicating whether that value is between the two arguments passed to betwee..
Calculate the specific weight of toluene : Calculate the specific weight of toluene at a place where the acceleration of gravity is 32.2 ft/s^2or 9.81 m/s^2. Express your answer in both lbf/ft^3 and kg/m^3. Repeat this for Mars whre the acceleration due to gravity is 37.5% of that on Earth.
Calsilite calcium silicate insulation blocks : Calcium Silicate has replaced asbestos as the preferred insulation for steam lines in power plants. Consider a 40 cm O.D., 4 cm wall thickness steel steam line insulated with a 12 cm thickness of calcium silicate. The insulation is protected from dam..
Determines the total due including sales tax and shipping : Create an application that determines the total due including sales tax and shipping. Allow the user to input any number of item prices. Sales tax of 7.75% is charged against the total purchases.
Adiabatic operation with negligible kineti-potential energy : A gas turbine receives a mixture having the following molar analysis: 10% CO2, 19% H2O, 71% N2 at 720 K, 0.35 MPa and a volumetric flow rate of 3.2 m3 /s. The mixture exits the turbine at 380 K, 0.11 MPa. For adiabatic operation with negligible kinet..
About the censorial axis about which the flywheel rotates : A flywheel can be considered as being composed of a thin disc and a rim. The rim weights 322 lb and has diameters of 24 in and 30 in (inside dia and outside diameter). The disc weights 64.4 lb. determine the mass moment of inertia about the censorial..
Develop a new strategy for the company : A case analysis requires students to develop a new strategy for the company and critically analyses how to ensure a sustainable source of competitive advantages.
Creation of a test plan document based on the requirements : Creation of a test plan document based on the requirements and design documents that were created earlier in this course.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Websites be required to adhere to section standards

what is the purpose then? Do you think that all websites should be required to adhere to Section 508 standards? Why or why not?

  Change the layout options to square

Change the layout options to Square

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Flowchart a program by using ms viso

Flowchart a program by MS Viso, using conventions presented in the text, that will prompt user to input a name and the number of credit hours taken towards their degree.

  Class named commission that includes two numeric variables

Create a class named Commission that includes two numeric variables: a sales figure and a commission rate. Also create two overloaded methods name computeCommission(). The first method takes two numeric arguments representing sales and rate, multi..

  Unix uses many commands in its operating system

Question 1: UNIX uses many commands in its operating system. Research on the web at least 2 more commands describe their function and discuss similar commands in Windows operating system.

  Create a server process that acts as a multiple client cpu

Prepare your own test data. On paper, work through your data showing Gantt charts, CPU utilization, and turnaround times. Use these same values for testing your program.

  The gorilla robot wants to play

The Gorilla Robot Wants to Play

  Consider a variant of cbc-mode encryption

Consider a variant of CBC-mode encryption where the sender simply increments the IV by 1 each time a message is encrypted (rather than choosing IV at random each time). Show that the resulting scheme is not CPA-secure.

  Addresses design issues and evaluation issues

A new design for an interactive device or some software application. It will provide the student with an overall look at the entire lifecycle of design from an HCI perspective. Feel free to incorporate techniques and references from the readings o..

  A calculator application that allows prefix, infix and postf

A calculator application that allows prefix, infix, and postfix expressions to be evaluated (i.e., allows all 3 types of expressions

  Coordination between functional areas of the firm

• What are the ways in which a marketing audit can help improve coordination between functional areas of the firm?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd