Determine independent variable and dependent variable

Assignment Help Basic Computer Science
Reference no: EM1368350

An experiment is set up to measure the time that a pendulum takes to swing back and forth 20 times. The pendulum consists of a mass at the end of a string and is released from a certain height above the lowest point in the pendulum's path. For the first part of the experiment, the length of the string is shortened by 5cm and the time is measured. What is the independent variable? What is the dependent variable? What should the controlled variables be?

Reference no: EM1368350

Questions Cloud

Determine the expected number of empty bins : Assume that n balls are tossed into n bins, where each toss is independent and ball is equally likely to end up in any bin. Determine the expected number of empty bins?
Compute the npv and irr on properties : Compute the NPV and IRR on each of these properties individually and collectively assuming a discount rate of 15 percent
Determine the cost function : Manchester Foundry produced 45,000 tons of steel in March at a expenses of $1,150,000. In April, foundry produced 35,000 tons at a cost of $950,000.
Question on first degree price discrimination : Two consumers, Consumer 1 and 2, purchase the same product. Compute the prices that should be charged to each customer if the seller is able to use first degree price discrimination.
Determine independent variable and dependent variable : The length of the string is shortened by 5cm and the time is measured. Determine the independent variable? Determine the dependent variable? What must the controlled variables be?
Explain the sales force serves as a critical link : Explain The sales force serves as a critical link between a company and its customers
Design a two part tariff structure : The Rusty Anchor Bar has two-types of patrons: legal and underage drinkers. Even though it is illegal to allow entry to underage drinkers, there is no perfect way to identify underage drinkers since they often use fake identification card.
How does cpu interface with device to coordinate transfer : Direct memory access is used for high-speed I/O devices to avoid increasing the CPUÂ ´s execution load. How does CPU interface with device to coordinate transfer?
Design electronic submission of assignments from students : This system must manage electronic submission of assignments from students to instructors. It must keep track of which students have submitted assignments and must allow instructors to manage the grading.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Laws and regulation in telecommunications field

Do you believe we require laws and regulation in telecommunications field at all? Why or why not?

  Explaining os not designed for smartphones and pdas

which OS is not designed for smartphones and PDAs?1. Which OS is not designed for smartphones and PDAs?

  Privilege to e-mail addresses in discount warehouse database

Checkout clerk with ____ privileges to e-mail addresses in discount warehouse database could view addresses but not change them.

  Determine subgame-perfect equilibrium

Targeting again one of the surviving gangsters. Survivors split money equally. Determine subgame-perfect equilibrium.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Describing dichotomy is not linearly separable

Let the d component of x be either 0 or 1. Assume we assign x to w1 if number of non-zero components of x is odd, and to w2 otherwise. Illustrate that this dichotomy is not linearly separable if d>1.

  Four ring architecture of operating systems

Opinion regarding what security benefit(s) would be seen if modern operating systems followed four ring architecture.

  Determine the size of data register

If the computer in this exercise uses the same size word for data and instructions determine the size of each data register? What is the size of the instruction register.

  Explaining straight-line depreciation method

Explain in scholarly detail how to carry out Straight-line Depreciation Method calculations.

  Creating report by city and by product to record sales

Create a report by city and another by product, including details of the sales and sub-totals and totals for quantity.

  Compare activity of disk required for each of the relational

Compare the activity (quite theoretical) of the disk (in number of bytes) required for each of both relational. Indicate the advantages and the inconveniences of the new relational scheme.

  Explain specific challenges facing the designer

Discuss the specific challenges of facing the designer, specifically with regard to the limitations of hardware, software and interface design two paragraph each.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd