Determine each root with a maximum absolute error

Assignment Help Basic Computer Science
Reference no: EM13208796

(a) In Matlab, use the function bisect in the le bisect.m to calculate roots of the following functions: f1(x) = x^2 -5 cos(x/3) in [0:5; 4] with max = 0:5x10^-10 f2(x) = sin(x) - x^2 in [0:5; 3:5] with max = 0:5 10^-7 f3(x) = 50(x)ln(x) -(pi)x^2 in [50; 100] with max = 0:5x10^-4 Determine each root with a maximum absolute error max and print the intermediate results. (b) Use Matlab's zero function to solve the equations from (a) with a high precision. Compare the results.

Reference no: EM13208796

Questions Cloud

State adding potassium methoxide to acetic acid : Two different solutions were prepared. Solution A was prepared by dissolving sodium acetate in methanol and solution B was prepared by adding potassium methoxide to acetic acid.
What effect policy will have on individuals property rights : Select a policy or proposed environmental policy and write a one page essay analyzing what the policy's stated goal is, whether the policy is likely to achieve this goal, what the costs of implementing the policy wll be, who will bear these costs.
Define the main product of the reaction : the main product of the reaction is 1-iodo-1,1-diphenylethane. Propose a plausible mechanism that accounts for the formation of this product. Use arrows to indicate electron flow in each step.
Describe would the hicks-kaldor criterion be useful : In fact, he has operated this livestock operation for over 20 years. in the past, his farm was fairly isolated. however more recently the nearest city, woodpile, has been expanding. thus, there are now residential homes fairly close to Brain's far..
Determine each root with a maximum absolute error : Determine each root with a maximum absolute error max and print the intermediate results. (b) Use Matlab's zero function to solve the equations from (a) with a high precision. Compare the results.
Explain ethyne as the only organic starting material : Propose a synthesis of 1,2-butanediol from ethyne as the only organic starting material. Your ethyne supply may be split to make different intermediates that, in turn
Will postal service meet its goal of reducing deficit policy : riority mail has been one of the most profitable products for the U.S Postal service, between 1995 -1999 and accounting for almost 8% of the Postal Service's mail revenue. Because the Postal Service lost $480 million in the fiscal year ending Sept..
Write the definition of a class clock : Write the definition of a class Clock . The class has no constructors and three instance variables. One is of type int called hours , initialized to 12 , another is of type boolean called isTicking , initialized to true , and the last one is of ty..
Define molecular formula of x and y : followed by acidification, gives compound Z with molecular formula C4H6O4, CH3CO2H and CO2. Both X and Y are optically active, while Z is optically inactive. Propose structures for X, Y and Z that are consistent with these data.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Explaining why facebook-s design is different

Why is Facebook's design different? Or has Google merely perfected something that most organizations have just now started to "tackle"?

  Construct the work breakdown structure

Construct the Work Breakdown Structure, define all of the activities and sequence these, schedule the project and then resource and budget the project using Microsoft Office Project.

  Structured english for clyde-s narrative of reimbursement

On trip lasting more than one day, we permit hotel, taxi, and airfare, also meal allowances. Same times apply for meal expenses." Write structured English for Clyde's narrative of reimbursement policies.

  Construct a diagram using rationale to map the arguments

An article from the press that cover any of the given topics, for example there have been many articles in the media recently about government surveillance.

  Explain use of gross domestic product-measure business cycle

Explain the use of Gross Domestic Product (GDP) to measure business cycle. Explain the roles of government bodies which determine national fiscal policies.

  Calculate the expected value for lottery game

Calculate the expected value for this game. Interpret what it means. Do not forget that you initially lose $1 by buying a ticket.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Explain how to generate array of random numbers

For some general variables L and U, write a comment that explains how to generate a 1 x N array of random numbers whose values are between L and U.

  Explain why you would want each feature

Explain why you would want each feature. Do you need to include any other devices in this design?

  Create a new group called mygroup

Directions: As you complete each of the following steps, keep track of what occurs at each point, including what you type, the output given, and if you experience any errors.

  Explain material protected under all copyright laws

All rights reserved. This material is protected under all copyright laws as they presently exist. No portion of this material may be reproduced, in any form or by any means, without permission in writing from publisher.

  Find out the average cpi for the two executables compiled

Consider a program compiled using compilers A and B running on the same processor. Find out the average CPI for the two executables compiled by compilers A and B given that the processor has a clock cycle time of 1ns.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd