User Account

All Pages

Design an iterative and a recursive function

Assignment Help Basic Computer Science
Reference no: EM131247834

Design an iterative and a recursive function called replicate_iter and replicate_recur respectively which will receive two arguments: times which is the number of times to repeat and data which is the number or string to be repeated.

The function should return an array containing repetitions of the data argument. For instance, replicate_recur(3, 5) or replicate_iter(3,5) should return [5,5,5]. If the times argument is negative or zero, return an empty array. If the argument is invalid, raise a ValueError.

Reference no: EM131247834

Questions Cloud

What was the chester corporations total assets : Midyear on July 31st, the Digby Corporation's balance sheet reported: Total Liabilities of $77.059 million Cash of $6.030 million Total Common Stock of $3.810 million Retained Earnings of $28.679 million. What was the Chester Corporation's total asse..
How did sources of comparative change over time : What concerns would Westland need to discuss before deciding to take advantage of this government subsidy? How did sources of comparative change over time and how did that likely influence the plans for Westland's production?
Explain project management as a discipline : Describe the industries in which project managers are in high demand. Provide evidence to support your response. Describe the general role of a project manager, and explain the primary ways in which it differs across different industries. Compare the..
Was this a beneficial period for women''s rights : What major event(s) from Jackson's Presidential administrations do you believe made the greatest impact on the shape of the country, and why? Your answer should address events such as, but not limited to, the American System, the Corrupt Bargain, ..
Design an iterative and a recursive function : Design an iterative and a recursive function called replicate_iter and replicate_recur respectively which will receive two arguments: times which is the number of times to repeat and data which is the number or string to be repeated.
Should jack suggest a pay policy to lead or match the market : Case - Nutriment's New Hires. Should Jack suggest a pay policy to lead, lag, or match the market? Explain your recommendation
What was the apparent motivation of the attacker : What company, government, organization (or group of them) was the target of the attack? Who was the attacker? If it's not know for certain, what is suspected and why? How did the attacker disrupt the target? (for instance, was it a DDOS attack, did t..
Transactions has on the accounting equation : Indicate the effect each of the following transactions has on the accounting equation (i.e., assets, liabilities, and equity). Enter the number corresponding to your answer in the box provided. Answer choices may be used once, more than once, or not ..
Create a powerpoint presentation : You will create a PowerPoint presentation to address the question below. Your PowerPoint presentation should be between 11-12 slides, and developed as if you are presenting to fellow colleagues within the IT industry.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Fraction with a denominator

Simplify each of the following algebraic expressions. All sets are assumed to be subsets of a universal set U.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Did the designs allow one to extract data into relevant info

Did the designs allow one to extract data into relevant informational views?Can the DBMS aide in making real time intelligent decisions?Can it aide in closing the loop from decision into action?

  What are the six barriers to affective planning

What are the six barriers to affective planning? How does each interfere with effective planning?

  What can be achieved by rivalry of neural network

What animal group will a bat be assigned to by the network modeled in the Example 02 program?

  Design a database schema for the proposed database design

Focus on one or two areas of your design that seemed especially difficult to develop and provide a brief assessment of the difficulty you encountered in modeling or mapping to the schema. In addition, provide the rationale for the design chosen, i..

  Generate the completion times of the jobs

generate the completion times of the jobs.

  Discuss the six images of managing change

1. In the first chapter of the textbook, you were introduced to four short stories of change. Select any one story and discuss the lessons that emerge from it. 2. Discuss the six images of managing change and how each can effect an organization.

  Design a second-order fir notch filter

a second order pole-zero notch filter for this purpose. In both cases choose the gain b0 so that |H(ω)| = 1 for ω = 0.

  Provide a brief historical perspective on right to privacy

Provide a brief historical perspective on the right to privacy. Can you identify key laws and legal rulings that provide the basis for the right to privacy?

  Categories of passive and active security attacks

List and briefly define at least three of the categories of passive and active security attacks.

  Identify some characteristics of a good control system

Identify some characteristics of a good control system.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd