Create advantages and efficiencies for an enterprise

Assignment Help Basic Computer Science
Reference no: EM13810620

1. Discuss how server virtualization, architecture, and Hyper-V can create advantages and efficiencies for an enterprise, including considerations for how to decide what an enterprise should factor in when calculating Return on Investment (ROI) before moving into server virtualization.

2. Explore the considerations useful when creating a terminal server farm, including additional streams of business income to cover ROI calculations, such as efficiencies in licensing, energy use, selling of resources (such as storage or computing and the attendant contractual responsibilities), as well as the advantages and disadvantages in elasticity of your own resources.

3. Various high-availability technologies are part of the Disaster Recovery Plan (DRP) and Business Continuity Plan (BCP) in many organizations. Considering the cost of implementation, identify which technology you think will give you the best ROI and why.

4. The 2001 terrorist attacks in NY and the subsequent collapse of the World Trade Center buildings had IT officials all over the world scrambling to revisit their high-availability implementations. Speculate on the lessons learned after 9/11 attacks in terms of disaster recovery. Describe what companies might do now that they were not doing before.

5. Speculate on the primary concerns of deploying AD RMS in a corporate environment. Recommend a strategy that you might use to mitigate these types of concerns during the initial implementation of the AD RMS. Provide a rational for your recommendation.

6. Select one (1) of the features of AD RMS and provide an example of an ideal situation or scenario in which an organization would implement the chosen feature. Next, provide an example of a situation or scenario in which an organization would want to restrict the use of your chosen feature. Justify your chosen examples.

Reference no: EM13810620

Questions Cloud

Describe the steps you have taken to maintain your site : Describe the steps you have taken to maintain and redesign your site over the past several weeks. How is the process that you followed similar to or different from how sites are maintained and redesigned in the professional environment
Draw the network diagram-find the critical path : Draw the network diagram. Find the critical path. If activities 1 and 10 cannot be shortened, but activities 2 through 9 can be shortened to a minimum of one week each at a cost of $ 10,000 per week, which activities would you shorten to cut the pr..
How do social forces play a role in our lives : How do social forces play a role in our lives
Sam stevens lives in an apartment building : Sam Stevens lives in an apartment building where he has been working on his new invention, a machine that plays the sound of a barking dog to scare off potential intruders. A national chain store that sells safety products wants to sell Sam's product..
Create advantages and efficiencies for an enterprise : Discuss how server virtualization, architecture, and Hyper-V can create advantages and efficiencies for an enterprise, including considerations for how to decide what an enterprise should factor in when calculating Return on Investment (ROI) befor..
Discuss the benefit of effective project closure : Discuss the benefit of effective project closure using examples to support your answer. Recommend two (2) best practices concerning project closure that would apply to almost any project.
A local motorcycle dealer''s newspaper advertisement : Leota Sage saw a local motorcycle dealer's newspaper advertisement offering a MetroRider EZ electric scooter for $1, 699. When she went to the dealership, however, she learned that the EZ model had been sold out. The salesperson told Sage the he stil..
What are the annual carrying costs of post card inventory : Post Card Depot, an large retailer of post cards, orders 3,361,530 post cards per year from its manufacturer. Post Card Depot plans on ordering post card 19 times over the next year. What are the annual carrying costs of post card inventory
Write calendar application which allows user to select date : The purpose of this lab is to give you a chance to use some of the data stream tools we have been discussing in a simple application. The assignment is to write a calendar application which allows the user to select a date, and either retrieve a p..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Circuit diagram-truth table for half subtractor-full adder

Illustrate the circuit diagram of the following circuit and create truth table for half subtractor and full adder. Full subtractor and Half adder.

  File name according to the section of the assignment

File name according to the section of the assignment

  List several possible causes for the connectivity issues

A few months after you complete the migration you are contacted because one of the employees has had persistent issues logging on to the network and believes that you may have made an error during the migration. You need to check the workstation to v..

  How many rows will truth table require if there six variable

How many rows will a Truth Table require if there are six variables and three conditions of each variable? Defend your answer.

  Write appropriate methods

Write a program that can be used to determine the tip amount that should be added to a restaurant  charge.

  Research and analyze a real world case

Research and analyze a real world case and create an audit report. This paper must include in it a detailed technical background information along with how the said threat was able to compromise the talked about target.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  It auditor certifications and requirements

Use the Web to conduct research on IT Auditor Certifications. Write a report which provides and explains the following: 3 IT Auditor Certifications and Requirements

  Course about communication

Explain how applying what you have learned in this course about communication, collaboration, problem solving skills, ethics and organizational citizenship can help you be a successful citizen of your organization. Be sure to discuss each one o..

  Explain least two social media and networking technologies

Analyze how the university might integrate at least two social media and networking technologies to accomplish their goals. Your analysis must cover the advantages and disadvantages of social networking. The president of the university also needs ..

  Create a program that reads number of dooflingies

The shipping clerk at Rinky Dooflingy Corporation is faced with the problem: Dooflingies are very deilicate and must be shipped in special containers.

  Using java create a basic coin-flip guessing game

Using JAVA create a basic coin-flip guessing game. The game should prompt the player to choose heads or tails, flip a virtual coin and then display the results to the player.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd