Cpu-best performance improvement for least amount of money

Assignment Help Basic Computer Science
Reference no: EM1363885

Suppose the daytime processing load consists of 60% CPU activityand 40% disk activity. Your customers are complaining that thesystem is slow. After doing some research, you learn that you canupgrade your disks for $8,000 to make them 2.5 times as fast asthey are currently. You have also learned that you can upgrade yourCPU to make it 1.4 times as fast for $5,000.

a) Which would you choose to yield the best performance improvementfor the least amount of money?

b) Which option would you choose if you don't care about the money,but want a faster system?

c)what is the break -even point for the upgrades ?that is , what price would we need to charge for the CPU (or the disk -change only one) so the result was the same cost per 1% increase for both?

Reference no: EM1363885

Questions Cloud

Critical thinking is clinical reasoning : The new term for "critical thinking" is now "clinical reasoning". In terms of our undergraduate students, how would you try to promote clinical reasoning in the classroom and in clinical?
How much work is done in stretching the spring : How much work is done in stretching the spring. Find out the constant acceleration of the car.
Accidental sharing of information : Accidental sharing of information - Accidental sharing of information can occur to anyone and unintentionally.
Budgets of isaac company : Isaac Company has a selling price of $10 per unit and expects to maintain ending inventories equal to 25 percent of the next month's sales. Calculate the budgeted beginning balance in units for finished goods inventory on November 1?
Cpu-best performance improvement for least amount of money : Suppose the daytime processing load consists of 60% CPU activityand 40% disk activity. Your customers are complaining that thesystem is slow. Which would you choose to yield the best performance improvement for the least amount of money?
Differentiate between anticommunsim and mccarthyism : Differentiate between Anticommunsim and McCarthyism , the perpective from which the media in 1947 to 1954 covered anticommunism and McCarthysim, american forgein policy desion impact anticommunism
High performing and low performing organizations : Find an organization that you believe is high performing and one that you believe is low performing
Explain and discuss performance appraisals : Explain and discuss performance appraisals and the process of developing performance appraisals and Describe and explain the role of performance appraisal in administrative decision making
Global warming and cause of hiv-aids infection : Considering the threat of global warming, take a position on whether or not this could play a role in infectious disease. Provide specific examples to support your response.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  What is achievable steady-state throughput

The receiver uses a conservative flow control policy and updates its credit allocation at every opportunity. What is the achievable steady-state throughput?

  Describing data-s confidentiality and integrity

They are asking candidates to describe briefly how they would satisfy StoreItRite's requirements as stated above. How would a successful candidate respond?

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Computing requirements for dozen handbags

Leather-goods factory manufactures ?ve styles of handbags, whose variable contributions are $30, $40, $45, $25, and $60 per dozen, respectively.

  Issue -internet changed political interactions globally

Write a 500 word essay based on the issue of ways in which the internet has changed political interactions globally. These might involve political activity in several specific countries,

  How silicon-based semiconductors revolutionized computing

New materials frequently lead to new technologies that change society. Describe how silicon-based semiconductors revolutionized computing.

  Probability and set theory questions

COMP 2804 Assignment 3,  The Fibonacci numbers are defined as follows,  Assume we roll each of D1, D2, and D3 once, independently of each other. Let R 1 , R2, and R3 be the numbers on the top face of D1, D2, and D3, respectively.

  Explaining good message digest function

Then calculate message digest on the result. Would this be a good message digest function? Describe. Message digests are reasonably fast.

  Button subprocedure to store user-s name in cell

If you wish to take in and store user's name in cell A1 by having them type their name following prompt declaring "Give me your name, Earthling!" that code excerpt must you use within button subprocedure?

  Calculate overall cost including installation-configuration

Calculate the overall cost, including installation, configuration, maintenance, ISP, and miscellaneous costs. Do not consider depreciation in the cost computation.

  Explaining function in sop and pos

Simplify the function in SOP and POS and draw logic gates design, using the minimum possible number of gates.(if you need to further simplify using Boolean algebra please do so).

  Pipelined machine versus the single cycle machine

What is the speedup of the pipelined machine versus the single cycle machine assuming there are no stalls?What is the speedup of the pipelined machine versus the single cycle machine if the pipeline stalls 1 cycle for 30% of the instructions?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd