Better data management helps the toronto globe

Assignment Help Basic Computer Science
Reference no: EM132747479

Better Data Management Helps the Toronto Globe and Mail Reach Its Customers

Have you ever received a new subscription offer from a newspaper or magazine to which you already subscribed? In addition to being an annoyance, sending a superfluous offer to customers increases marketing costs. So why is this happening? The answer is probably because of poor data management. The newspaper most likely was unable to match its existing subscriber list, which it maintained in one place, with another file containing its list of marketing prospects.

The Globe and Mail, based in Toronto, Canada, was one of those publications that had these problems. In print for 167 years, it is Canada's largest newspaper, with a cumulative six-day readership of nearly 3.3 million. The paper has a very ambitious marketing program, viewing every Canadian household that does not already subscribe as a prospect. But it has had trouble housing and managing the data on these prospects.

Running a major newspaper requires managing huge amounts of data, including circulation data, advertising revenue data, marketing prospect and "do not contact" data, and data on logistics and deliveries. Add to that the data required to run any business, including finance and human resources data.

For many years The Globe and Mail housed much of its data in a mainframe system where the data were not easy to access and analyze. If users needed any information, they had to extract the data from the mainframe and bring it to one of a number of local databases for analysis, including those maintained in Microsoft Access, Foxbase Pro, and Microsoft Excel. This practice created numerous pockets of data maintained in isolated databases for specific purposes but no central repository where the most up-to-date data could be accessed from a single place. With data scattered in so many different systems throughout the company, it was very difficult to cross-reference subscribers with prospects when developing the mailing list for a marketing campaign. There were also security issues: The Globe and Mail collects and stores customer payment information, and housing this confidential data in multiple places makes it more difficult to ensure that proper data security controls are in place.

In 2002, the newspaper began addressing these problems by implementing a SAP enterprise system with a SAP NetWeaver BW data warehouse that would contain all of the company's data from its various data sources in a single location where the data could be easily accessed and analyzed by business users.

The first data to populate the data warehouse was advertising sales data, which is a major source of revenue. In 2007, The Globe and Mail added circulation data to the warehouse, including delivery data details such as how much time is left on a customer's subscription and data on marketing prospects from third-party sources. Data on prospects were added to the warehouse as well.

With all these data in a single place, the paper can easily match prospect and customer data to avoid targeting existing customers with subscription promotions. It can also match the data to "do not contact" and delivery area data to determine if a newspaper can be delivered or whether a customer should be targeted with a promotion for a digital subscription.

Despite the obvious benefits of the new data warehouse, not all of The Globe and Mail's business users immediately came on board. People who were used to extracting data from the mainframe system and manipulating it in their own local databases or file continued to do the same thing after the data warehouse went live. They did not understand the concept of a data warehouse or the need to work towards enterprise-wide data management. The Globe and Mail's management decided to tackle this new problem by educating its users, especially its marketing professionals, with the value of having all the organization's data in a data warehouse and the tools available for accessing and analyzing these data.

The Globe and Mail's new data analysis capabilities produced savings from efficiencies and streamlined processes that paid for the investment in one year. Marketing campaigns that previously took two weeks to complete now only take one day. The newspaper can determine its saturation rates in a given area to guide its marketing plans. And there are fewer complaints from subscribers and potential subscribers about being contacted unnecessarily.

To capitalize further on data management and analytics, The Globe and Mail turned to the cloud. A key business goal for the company was to beef up online content and increase the paper's digital subscriber base. The Globe and Mail devoted more resources to digital online content, with different subscription rates for online-only customers and print customers. To aggressively court digital subscribers, The Globe and Mail had to mine its clickstream data logging user actions on the Web to target potential digital subscribers based not only on their specific interests but also their interests on a particular day. The volume of data was too large to be handled by the company's conventional Oracle database. The solution was to use SAP HANA ONE in-memory computing software running on the Amazon Web Services cloud computing platform, which accelerates data analysis and processing by storing data in the computer's main memory (RAM) rather than on external storage devices. This cloud solution lets The Globe and Mail pay for only what capabilities it uses on an hourly basis.

Reference no: EM132747479

Questions Cloud

Identify the new strand of dna : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine
What is the implied exchange rate at maturity : A comparable risk five year, 5.5 percent yen/dollar dual currency bond pays $833.44 at maturity per ¥100,000 of face value. What is the implied exchange rate
State which eylf practice links best : State which EYLF Practice links best. The ECA Code of Ethics and the United Nations Convention on the Rights of the Child support play
Morphological types of chronic inflammation : What are the morphological types of chronic inflammation? What is the type and pathological changes of chronic gastritis?
Better data management helps the toronto globe : Better Data Management Helps the Toronto Globe and Mail Reach Its Customers
What recommendations would you make to address the issues : What are the people issues and how do these relate to key OB concepts and theories? What recommendations would you make to address these issues?
Make a simple labelled diagram of a hypha : Make a simple labelled diagram of a hypha. Use your diagram to explain what is unusual about the cell structure of fungi
What is the effective rate for the year : A financial institution quotes a rate of 2.36 percent compounded daily. What is the effective rate for the year using a 365 day year
Which statements considered reasonable accommodation : One of the engineers at Clearwater Electronics, Which statements would be considered the best "reasonable accommodation" HR can present to the supervisor?

Reviews

Write a Review

Basic Computer Science Questions & Answers

  What is the value of x after the assignment statement

What is the value of x after the assignment statement

  Flexible single master operations roles

Flexible Single Master Operations Roles

  Developed economies need to grow all the time

Using the Solow growth model explain is the main reason ostensibly that developed economies need to grow all the time?

  Important for organizations to have disaster recovery plan

Why is it important for organizations to have a business continuity plan in place? Why is important for organizations to have a disaster recovery plan?

  Discusses different roles in data visualization

Kirk (2016) discusses the different roles in data visualization in the textbook. Describe the role or roles you would likely fill on a team.

  The problem of eavesdropping in traditional cryptography

How does quantum cryptography eliminate the problem of eavesdropping in traditional cryptography?

  Introduction to computing

Research at least three different executive support systems using a web search. Review each, and then answer the following questions: 1. Which ESSs did you review? Include a link to information about it.

  Find the square root of the number stored

Write the code to find the square root of the number stored in the first element in a one-dimensional double array named math Numbers. Display the result on the screen.

  Discuss about the throw statement

A program contains the statement throw; Where would you normally expect to find such a statement? What if that statement appeared in a different part.

  Find the probability of a pregnancy lasting

Find the probability of a pregnancy lasting longer than 308 days. What do your results suggest?

  How many persons were blue-eyed on the island

On the 43rd night after this happens, many inhabitants flee from the island. How many persons were blue-eyed on the island?

  Discusses broad context of risk and investigative forensics

Discusses broad context of risk and investigative forensics. Part of risk management is to understand when things go wrong,

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd