How do cells get energy for their functioning, Biology

Assignment Help:

Q How do cells get energy for their functioning?

Cells get energy for their metabolic reactions from the breaking of organic molecules with high energetic content. This energy is mostly stored as ATP molecules.

The process of acquiring energy in order to produce ATP molecules is named cellular respiration.


Related Discussions:- How do cells get energy for their functioning

What is malabsorption syndrome, Q. What is Malabsorption Syndrome? Did ...

Q. What is Malabsorption Syndrome? Did you know that a major part of the absorption of nutrients takes place in the small intestine and the set of enzymes involved in this proc

Define the starch gel electrophoresis, Define the Starch gel electrophoresi...

Define the Starch gel electrophoresis? Starch gel has the advantage of fine texture and absence of protein adsorption with a molecular sieving effect retarding proteins of larg

Define pre-exercise or pre-event meal for athletes, Define Pre-Exercise or ...

Define Pre-Exercise or Pre-Event Meal for athletes? Suitable foods in adequate quantities at all times should be consumed but before the event, strategies to fuel up the energ

Theory of embryology - germ plasm theory, GER M PLASM THEORY - It w...

GER M PLASM THEORY - It was proposed by Weismann. According to it, two types of cells are formed during embryonic development viz - Germ cell & Somatic cell. The germ ce

Ink prints of leaves, Ink prints of leaves Place a small quantity of pr...

Ink prints of leaves Place a small quantity of printer's ink on a sheet of glass or a tile. Roll the ink into a thin yet layer with a rubber roller. Place a leaf, vein side up,

Determine the seeds in the plant kingdom, What is the evolutionary importan...

What is the evolutionary importance of the emergence of seeds in the plant kingdom? The evolutionary significance of the seed is related to the plant capability of distant colo

Cytoplasm, CYTOPLASM Name proposed by Strassburger. According to Muhlet...

CYTOPLASM Name proposed by Strassburger. According to Muhlethaler and Frey- Wyssling fluid outside nucleus is called cytoplasm. Two parts of cytoplasm. (1) Hyaloplasm or

Which of the following statements is not true of mitosis, Which of the foll...

Which of the following statements is not true of mitosis? A. The original cell produces two identical daughter cells B. It follows duplication of DNA in the nucleus C. It involves

Evolution , What benefits led to natural selection of a two-circuit pump f...

What benefits led to natural selection of a two-circuit pump function of the heart a) One circuit to go from the heart to the body and one from the heart to the lungs b) One cir

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd