Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q How do cells get energy for their functioning?
Cells get energy for their metabolic reactions from the breaking of organic molecules with high energetic content. This energy is mostly stored as ATP molecules.
The process of acquiring energy in order to produce ATP molecules is named cellular respiration.
Q. What is Malabsorption Syndrome? Did you know that a major part of the absorption of nutrients takes place in the small intestine and the set of enzymes involved in this proc
Define the Starch gel electrophoresis? Starch gel has the advantage of fine texture and absence of protein adsorption with a molecular sieving effect retarding proteins of larg
Define Pre-Exercise or Pre-Event Meal for athletes? Suitable foods in adequate quantities at all times should be consumed but before the event, strategies to fuel up the energ
GER M PLASM THEORY - It was proposed by Weismann. According to it, two types of cells are formed during embryonic development viz - Germ cell & Somatic cell. The germ ce
Ink prints of leaves Place a small quantity of printer's ink on a sheet of glass or a tile. Roll the ink into a thin yet layer with a rubber roller. Place a leaf, vein side up,
What is the evolutionary importance of the emergence of seeds in the plant kingdom? The evolutionary significance of the seed is related to the plant capability of distant colo
CYTOPLASM Name proposed by Strassburger. According to Muhlethaler and Frey- Wyssling fluid outside nucleus is called cytoplasm. Two parts of cytoplasm. (1) Hyaloplasm or
Which of the following statements is not true of mitosis? A. The original cell produces two identical daughter cells B. It follows duplication of DNA in the nucleus C. It involves
What benefits led to natural selection of a two-circuit pump function of the heart a) One circuit to go from the heart to the body and one from the heart to the lungs b) One cir
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd