Define the functions of vitamin a, Biology

Assignment Help:

Define the Functions of Vitamin A?

Vitamin A (retinol) is an essential nutrient needed in small amounts by humans for the normal functioning of the visual system, growth and development, and maintenance of epithelial cellular integrity, immune function, and reproduction. While we discuss the major functions of vitamin A, it is important to note  &at primary vitamin A deficiency (VAD) may give rise to more than one secondary  effects which can of tell be recognized in the form of clinical signs and symptoms  most important  being ocular manifestations grouped under 'xerophthamia. In addition to the specific signs and symptoms of xerophthamia and the risk of irreversible blindness, nonspecific symptoms include increased morbidity  and mortality, poor reproductive health, increased risk of anaemia, and contributions  o depressed growth and development.


Related Discussions:- Define the functions of vitamin a

Explain the toxicity of vitamin d, Explain the Toxicity of Vitamin D? ...

Explain the Toxicity of Vitamin D? The adverse effects of high vitamin D intakes include hypercalciuria (excessive urinary calcium excretion) and hypercalcaemia (high concentr

Indications for surgery-mixed tricuspid stenosi , Indications for Surgery: ...

Indications for Surgery:  In a mixed lesion, either regurgitation or stenosis may be dominant and decision of surgery depends on the haemodynarnics. At the time of surgery on othe

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain genetically modified foods, Normal 0 false false fa...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Which is better-scrubbing the instruments or ultrasonic bath, Q. Which is b...

Q. Which is better-scrubbing the instruments or ultrasonic bath to clean the instruments? Ultrasonic bath to clean the instruments is better than hand scrubbing the instruments

Describe female and male surgical sterilization, Q. What are the most commo...

Q. What are the most common methods of female and male surgical sterilization? Vasectomy is the majority common method of surgical sterilization in men in vasectomy the vas def

Ribosomes, Ribosomes - It is also known as Protein factory, Engine ...

Ribosomes - It is also known as Protein factory, Engine of the cell. Ribosomes are smallest cell organelles (150 x 250 Å). Unit membrane less cell organelle. Ribo

Explain about the pharmaceutical management, Explain about the Pharmaceutic...

Explain about the Pharmaceutical Management? A person with BMI 30 and above may require pharmaceutical management in addition to dietary and lifestyle modifications. It may als

Define prevention of idd by iodized oil, Define prevention of idd by Iodize...

Define prevention of idd by Iodized Oil? The other approach employed as a specific measure for women and children in hyper-endemic areas is injection of iodized oil. Intramuscu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd