Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the Functions of Vitamin A?
Vitamin A (retinol) is an essential nutrient needed in small amounts by humans for the normal functioning of the visual system, growth and development, and maintenance of epithelial cellular integrity, immune function, and reproduction. While we discuss the major functions of vitamin A, it is important to note &at primary vitamin A deficiency (VAD) may give rise to more than one secondary effects which can of tell be recognized in the form of clinical signs and symptoms most important being ocular manifestations grouped under 'xerophthamia. In addition to the specific signs and symptoms of xerophthamia and the risk of irreversible blindness, nonspecific symptoms include increased morbidity and mortality, poor reproductive health, increased risk of anaemia, and contributions o depressed growth and development.
Explain the Toxicity of Vitamin D? The adverse effects of high vitamin D intakes include hypercalciuria (excessive urinary calcium excretion) and hypercalcaemia (high concentr
Indications for Surgery: In a mixed lesion, either regurgitation or stenosis may be dominant and decision of surgery depends on the haemodynarnics. At the time of surgery on othe
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Q. Which is better-scrubbing the instruments or ultrasonic bath to clean the instruments? Ultrasonic bath to clean the instruments is better than hand scrubbing the instruments
Q. What are the most common methods of female and male surgical sterilization? Vasectomy is the majority common method of surgical sterilization in men in vasectomy the vas def
taxonomy research cat
Ribosomes - It is also known as Protein factory, Engine of the cell. Ribosomes are smallest cell organelles (150 x 250 Å). Unit membrane less cell organelle. Ribo
Explain about the Pharmaceutical Management? A person with BMI 30 and above may require pharmaceutical management in addition to dietary and lifestyle modifications. It may als
Define prevention of idd by Iodized Oil? The other approach employed as a specific measure for women and children in hyper-endemic areas is injection of iodized oil. Intramuscu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd