classification, Biology

discuss about protozoa,metazoa,mesozoa and parazoa
Posted Date: 1/17/2015 2:52:44 AM | Location : Tanzania, United Republic of







Related Discussions:- classification, Assignment Help, Ask Question on classification, Get Answer, Expert's Help, classification Discussions

Write discussion on classification
Your posts are moderated
Related Questions
URETHRA - It is common duct as sperms & urine both pass from it. It receives juices of prostatic gland & cowper's gland. Urethra is 20 cm long, passes through the peni

Q. Which type of polarity do water-soluble and fat-soluble substances respectively have? Water-soluble substances are polar molecules that are they have electrically charged ar

Retention of Soil Moisture The movement of water into and within the soil, moisture storing capacity of soils and the availability of moisture to plants are governed by soil pr

Describe the Neuropsychological Assessment of Infants Neuropsychological Assessment of Infants and Young Children followed by the developmental Concepts Unique to Infants and

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the pH Meter - Food Microbiology? pH is a negative logarithm of H+ ion concentration. Its value remains between 0 and 14. Pure water has a pH of 7 (neutral). pH value l

Amylose Amylose molecules have molecular weights ranging from 10 4 -20 6 . Amylose can form an extended shape (hydrodynamic radius 7-22 nm) but generally tends to wind up into

Explain Generation of sound in MVP? Generation of sound in MVP: These are generated due to sudden tensing of redundant leaflets and elongated of chordae tendinae. Interventions

Tests of shelled amoebas are made from a variety of substances including sand grains, chitin and substrate, calcium salts, and even silica. These shells still accumulate in ocean d

Q. Dietary Guidelines fur hyperlipidemic patients? • Calories: to maintain ideal body weight. • Carbohydrates should constitute 55-65% of calories with emphasis on • polysacc