Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Cnidarian identity card. How are they characterized according to instance of representing beings, basic morphology, kind of symmetry, germ layers and coelom, digestive system, respiratory system, circulatory system, excretory system, nervous system and types of reproduction?
Examples of representing beings: jellyfish, sea anemones, corals, hydra. Basic morphology: medusa or polyp. Type of symmetry: radial. Germ layers and coelom: acoelomate ,diploblastics. Digestive system: incomplete. Respiratory system: nonexistent. Circulatory system: nonexistent. Excretory system: nonexistent. Nervous system: diffuse. Kindss of reproduction: sexual and asexual with metagenesis and larval stage.
Explain the Pathogens of forest insects? Caterpillars that defoliate forest trees have main economic impacts. Many such species go through periodic outbreaks. The forces which
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Database Search: Once an open reading frame or the partial amino acid sequence has been pre-determined, the investigator compares sequence with others in the databases using a com
What are the illustrations of the criminal law? Illustrations of crimes' law: Illustrations of crimes are theft, reckless or murder behaviour. The major aim of illegal
Explain holding method of pasteurization In the holding method of pasteurization (62 o C for 30 minutes) or the high-temperature short-time (HTST), 71 o C for 15 minutes method
cours
How do you convert 147.05mg% of plasma glucose to mM/L please show work.
What are the Pupillary defects There are certain deviations from normal pupillary reflexes which point towards certain specific pathology.
Animal Cloning: When entire animals are obtained from somatic cells of an animal, it is known as animal cloning. Cloning is usual in plants but in case of animals only some deg
Explain the Marasmus - protein energy malnutrition? Marasmus, the other end of the same spectrum as kwashiorkor, is common in children below the age of 2 years. The characteris
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd