Organism eukaryotic or prokaryotic

Assignment Help Biology
Reference no: EM132280180

1. Suppose that you are a biologist out for a stroll at Dash Point State Park on the Puget Sound and notice many fish have washed up dead on the beach. Upon examination you find small red lesions in their skin. You examine the lesions under a microscope and find a single celled organism that has a cell was, green organelles and a nucleus, but NO mitochondria.

a. Is this organism eukaryotic or prokaryotic? Explain your reasoning.

b. Which domains does this organism not belong to? Explain your reasoning.

c. To which biological domain does this organism belong? If the organism belongs to domain Eukarya, which kingdom does it belong to? Explain your reasoning.

2.What would be the sequence of the complementary DNA strand to this one:

AGCAATGCATGCATCGTTATGG

Reference no: EM132280180

Can a bacteriostatic agent become bactericidal

What experiment could be performed to ascertain if an antimicrobial agent is bactericidal or bacteriostatic? Can a bacteriostatic agent become bactericidal in the long run o

Using the microscope simulator

This first assignment worth 20 points is using the microscope simulator. It will require you to follow thetour and you should use the recommended checklist. You will answer th

Explain the regional differences

Gene frequencies for the ABO alleles vary geographically. For example the I^A allele makes up nearly 50 percent of the genes for blood type among Australian Aborigines, about

Why are only two molecules of nadh formed during glycolysis

The free energy for the oxidation of glucose to co2 and water is-686 kcal/mole and the free energy for the reduction of NAD+ to NADH is +53 kcal/mole. Why are only two molec

What are the differences in trait versus process leadership

In your opinion, what are the differences in trait versus process leadership?   Which do you think is more powerful?  Is one type of leadership more valuable in certain situat

What type of dna sequences make up majority of genome

Do more complex organisms always have more genes than less complex organisms? Give an example to support your answer and what type of DNA sequences make up the majority of the

What are common signs of cor pulmonale

What are common signs of Cor Pulmonale? A) rales and rhonchi B) paroxymal nocturnal dyspnea C) secondary polycythemia and cyanosis D) heptomegaly and edema in the legs.

Predicting the frequency of progeny

Genes A, B, and C are linked on a chromosome and found in the order A-B-C. Genes A and B recombine with a frequency of 8%, and genes B and Crecombine at a frequency of 24%.

Reviews

Write a Review

 
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd