Organism eukaryotic or prokaryotic

Assignment Help Biology
Reference no: EM132280180

1. Suppose that you are a biologist out for a stroll at Dash Point State Park on the Puget Sound and notice many fish have washed up dead on the beach. Upon examination you find small red lesions in their skin. You examine the lesions under a microscope and find a single celled organism that has a cell was, green organelles and a nucleus, but NO mitochondria.

a. Is this organism eukaryotic or prokaryotic? Explain your reasoning.

b. Which domains does this organism not belong to? Explain your reasoning.

c. To which biological domain does this organism belong? If the organism belongs to domain Eukarya, which kingdom does it belong to? Explain your reasoning.

2.What would be the sequence of the complementary DNA strand to this one:

AGCAATGCATGCATCGTTATGG

Reference no: EM132280180

The cardiac center in the medulla of the brain

The cardiac center in the medulla of the brain increases the rate of heart beat (and blood pressure) through the accelerator nerve, and slows the heart rate (and lowers blood

What is functional unit of kidney in which urine is formed

What is the functional unit of the kidney in which urine is formed? Which of these is a density dependent factor in terms of its effect on populations? Population density

Best-known and most admired companies

END OF CHAPTER CASE-GOOGLE Google is one of the best-known and most admired companies around the world. [1] So much so that googling is the term many use to refer to searchi

How many phage per ml were in the original stock

You serially dilute a stock of bacteriophage by sequentially taking: 10 ul into 1 ml, 10 ul into 1 ml, 100 ul into 0.9 ml and plating 0.1 ml on a sensitive strain of bacteri

Why they are able to retain food for so long

Food remains in the stomach for several hours. Passage of food through the small intestines also requires several hours. These two organs have very different shapes. Explain

Viral infections are more difficult to treat than bacterial

Explain why the response of third line of defence, both cellularand antibody immunity, is specific in nature.  Explain why viral infections are more difficult to treat thanbac

Define the neurospora dna and plasmid

A kan-r, tet-r plasmid is treated with the restriction enzymeBglI, What anitbiotic would you put in the growth medium to ensure that each colony has the plasmid, Which phenoty

What is the average size of a yeast cell

You count 74 cfu on a pour plate. The plate was prepared by spreading 0.2 ml of a 1:10,000 dilution of the original sample. What is the density of the original culture (in c

Reviews

Write a Review

 
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd