User Account

All Pages

Organism eukaryotic or prokaryotic

Assignment Help Biology
Reference no: EM132280180

1. Suppose that you are a biologist out for a stroll at Dash Point State Park on the Puget Sound and notice many fish have washed up dead on the beach. Upon examination you find small red lesions in their skin. You examine the lesions under a microscope and find a single celled organism that has a cell was, green organelles and a nucleus, but NO mitochondria.

a. Is this organism eukaryotic or prokaryotic? Explain your reasoning.

b. Which domains does this organism not belong to? Explain your reasoning.

c. To which biological domain does this organism belong? If the organism belongs to domain Eukarya, which kingdom does it belong to? Explain your reasoning.

2.What would be the sequence of the complementary DNA strand to this one:

AGCAATGCATGCATCGTTATGG

Reference no: EM132280180

Questions Cloud

Write a brief background essay on the country : What you need? A brief essay determining where the economy lies in the business cycle (data is helpful!). A brief background essay on the country.
How do you think the optimal temperature for enzymes : How do you think the optimal temperature for enzymes found in thermophile bacteria living in hot pools differ from that of the enzymes found in your body?
Create a workflow diagram to illustrate how analytics could : Oak Room Furniture gained a niche following with local developers needing quality furniture to help stage their new model homes in budding communities.
Four functions related to the work process : How are the four functions related to the work process?
Organism eukaryotic or prokaryotic : You examine the lesions under a microscope and find a single celled organism that has a cell was, green organelles and a nucleus, but NO mitochondria.
What effect would the presence of antimycin a : What effect would the presence of Antimycin A have on the amount of NAD+, NADH, pyruvate, and oxygen present in the cell?
Design a query that will allow the finance department : The sales department is the only department where employees are paid a commission in addition to their yearly salary and benefits.
How does this in turn affect blackworm pulse rate : How does nicotine affect blackworm muscle cells, and how does this in turn affect blackworm pulse rate?
What are the important determinants of economic growth : What have been the most important determinants of economic growth in Japan over the past 10 years? The response must be typed, single spaced.

Reviews

Write a Review

Biology Questions & Answers

  What is one benefit of eating a lunch rich in vitamin d

What is one benefit of eating a lunch rich in Vitamin D and what can you do to ensure you are getting the daily recommended intake of Vitamin D?

  Difference between isotonic and isometric contractions

Describe the difference between isotonic and isometric contractions. What differences did you notice between the spongy and compact bone?

  Populations of the checkerspot butterfly

In the Sierra Nevada mountains of California there are many populations of the checkerspot butterfly, Euphydryas editha.

  How the innovation appears to have happened

Over the long period of time that life has existed on Earth, there have been a number of important or significant innovations including (but not limited to) endosymbiosis to create mitochondria and chloroplasts.

  Analyze your selected psychological measure

Based on the analysis of your articles, discuss the use of your selected measure. Explain who is qualified to administer and interpret the measure and the settings-such as occupational, academic, or counseling-in which it would be appropriate to u..

  Provide signs of scid

Provide two signs of SCID. Explain two options for expecting parents who have family members with SCID and are concerned their child will be affected with the immunodeficiency.

  Calculate the response factor for the analyte

A solution containing 3.45 mM of p-xylene (analyte) and 6.86 mM of nonane (standard) gave peak areas of 13587 and 14769 respectively, in a chromatographic analysis. then 1.5 mL of 6.86mM nonane solution was added to 5 mL of an unknown sample conta..

  Describe the cyclic activated-sludge system

Describe the Cyclic Activated-Sludge System, discuss its mode of operation and the potential benefits as an equipment option for an activated sludge unit to be designed into a batch wastewater pretreatment system. Your response should be at least ..

  How will the concomitant increase in temperatures

CO2 levels have increased worldwide due to anthropogenic emissions. Projections suggest these will continue to increase over the rest of our lifetimes.

  Difference between octopuses and mussels

What is the difference between octopuses and mussels regarding their circulatory systems? How does that difference influence the mobility of these animals?

  What are the first five bases that primase synthesizes

What are the first five bases that primase synthesizes? ( before DNA polymerase I and DNA ligase have modified this molecule)?

  Significant pathways of phosphorus in the atmosphere

Identify the significant pathways of Phosphorus in the atmosphere, hydrosphere, biosphere, and pedosphere. Where are the major stores?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd