User Account

All Pages

Organism eukaryotic or prokaryotic

Assignment Help Biology
Reference no: EM132280180

1. Suppose that you are a biologist out for a stroll at Dash Point State Park on the Puget Sound and notice many fish have washed up dead on the beach. Upon examination you find small red lesions in their skin. You examine the lesions under a microscope and find a single celled organism that has a cell was, green organelles and a nucleus, but NO mitochondria.

a. Is this organism eukaryotic or prokaryotic? Explain your reasoning.

b. Which domains does this organism not belong to? Explain your reasoning.

c. To which biological domain does this organism belong? If the organism belongs to domain Eukarya, which kingdom does it belong to? Explain your reasoning.

2.What would be the sequence of the complementary DNA strand to this one:

AGCAATGCATGCATCGTTATGG

Reference no: EM132280180

Questions Cloud

Write a brief background essay on the country : What you need? A brief essay determining where the economy lies in the business cycle (data is helpful!). A brief background essay on the country.
How do you think the optimal temperature for enzymes : How do you think the optimal temperature for enzymes found in thermophile bacteria living in hot pools differ from that of the enzymes found in your body?
Create a workflow diagram to illustrate how analytics could : Oak Room Furniture gained a niche following with local developers needing quality furniture to help stage their new model homes in budding communities.
Four functions related to the work process : How are the four functions related to the work process?
Organism eukaryotic or prokaryotic : You examine the lesions under a microscope and find a single celled organism that has a cell was, green organelles and a nucleus, but NO mitochondria.
What effect would the presence of antimycin a : What effect would the presence of Antimycin A have on the amount of NAD+, NADH, pyruvate, and oxygen present in the cell?
Design a query that will allow the finance department : The sales department is the only department where employees are paid a commission in addition to their yearly salary and benefits.
How does this in turn affect blackworm pulse rate : How does nicotine affect blackworm muscle cells, and how does this in turn affect blackworm pulse rate?
What are the important determinants of economic growth : What have been the most important determinants of economic growth in Japan over the past 10 years? The response must be typed, single spaced.

Reviews

Write a Review

Biology Questions & Answers

  How does the behavior of transformed cells differ

Normal cells greatly slow their rates of cell division after filling a culture dish with a layer one cell deep (a monolayer). How does the behavior of transformed cells differ

  Effect of temperature on catechol oxidase activity

Write the null hypothesis for the effect of temperature on catechol oxidase activity?

  What size bands would you expect to see

You insert a 7 kb segment of mouse DNA into the SV40 chromosome (SV40 DNA = 7.5 kb), creating a recombinant viral chromosome. You then transfect a culture of chimpanzee kidney cells with this DNA.

  Special focus on spinal cord injuries

1. Explain how stems cells are can be used to treat diseases and injury, with special focus on spinal cord injuries.

  Percent of gc content for each of primers

When designing primers, it is ideal to have a minimum GC content of 40%. What is the percent of GC content for each of the primers designed in Data Table 4? Are the primers considered "ideal" in terms of GC content?  Explain your answer.

  Total mass of solids remaining

What is the extent of reaction, ?, when the total mass of solids remaining (KClO3 plus KCl) is 5.52 g?

  How many different gamete genotypes are possible

Assume a plant has the following genotype: AaBbCcDdee. How many different gamete genotypes are possible for these genes if they are unlinked?

  Q1 use of synthetic fertilizers often leads to the

q1. use of synthetic fertilizers often leads to the contamination of groundwater with nitrates. nitrate pollution is

  Why did johnny have poor healing

If the genes were expressed in the cell, predict that signal would win out for the following combinations. Give details your reasoning.

  Which organelle compares to which part of your analogy

Make sure you include a labeled picture of what you are comparing your cell to (even though my picture is not labeled. This is NOT a picture of a cell, but of a soccer field or Pizza hut, or a car etc.)

  Describe how the structure of dna is correlated

The continuity of life is based on heritable information in the form of DNA, and structure and function are correlated at all levels of biological organization. In a short essay (100-150 words), describe how the structure of DNA is correlated with..

  What is the difference between sex cells and somatic cells

How is cell division and differentiation different from binary fission? What is the difference between sex cells and somatic cells?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd