User Account

All Pages

Organism eukaryotic or prokaryotic

Assignment Help Biology
Reference no: EM132280180

1. Suppose that you are a biologist out for a stroll at Dash Point State Park on the Puget Sound and notice many fish have washed up dead on the beach. Upon examination you find small red lesions in their skin. You examine the lesions under a microscope and find a single celled organism that has a cell was, green organelles and a nucleus, but NO mitochondria.

a. Is this organism eukaryotic or prokaryotic? Explain your reasoning.

b. Which domains does this organism not belong to? Explain your reasoning.

c. To which biological domain does this organism belong? If the organism belongs to domain Eukarya, which kingdom does it belong to? Explain your reasoning.

2.What would be the sequence of the complementary DNA strand to this one:

AGCAATGCATGCATCGTTATGG

Reference no: EM132280180

Questions Cloud

Write a brief background essay on the country : What you need? A brief essay determining where the economy lies in the business cycle (data is helpful!). A brief background essay on the country.
How do you think the optimal temperature for enzymes : How do you think the optimal temperature for enzymes found in thermophile bacteria living in hot pools differ from that of the enzymes found in your body?
Create a workflow diagram to illustrate how analytics could : Oak Room Furniture gained a niche following with local developers needing quality furniture to help stage their new model homes in budding communities.
Four functions related to the work process : How are the four functions related to the work process?
Organism eukaryotic or prokaryotic : You examine the lesions under a microscope and find a single celled organism that has a cell was, green organelles and a nucleus, but NO mitochondria.
What effect would the presence of antimycin a : What effect would the presence of Antimycin A have on the amount of NAD+, NADH, pyruvate, and oxygen present in the cell?
Design a query that will allow the finance department : The sales department is the only department where employees are paid a commission in addition to their yearly salary and benefits.
How does this in turn affect blackworm pulse rate : How does nicotine affect blackworm muscle cells, and how does this in turn affect blackworm pulse rate?
What are the important determinants of economic growth : What have been the most important determinants of economic growth in Japan over the past 10 years? The response must be typed, single spaced.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +91-977-207-8620

Phone: +91-977-207-8620

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd