Identify position-indicate what pattern is found in thread

Assignment Help Basic Computer Science

Reference no: EM1361874

Assume we encode A, T, C, and G as two bit codes A:00, T:01, C:10, and G:11, respectively. Given the sequence AATCGATAAGCAAAACCGGA, build a hash table with all possible 3-mers from this sequence.

Problem 2. Given the patterns listed below:
P1=ATCGAT, P2=CGATAT, P3=AAGCAA, P4=CCGCAT, and P5=ATCCAT.

1) Build a keyword tree based on these patterns;

2) Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

Reference no: EM1361874

Questions Cloud

Body fat and diet program : A 5'9", 140lb 32 year old female has a body fat percentage of 32% when measured using the BodPod. How accurate is her assessment? Where does she stand? Design a one week diet program to help her reach her goals.

What is the speed of lander just before it touches surface : Three astronauts, propelled by jet backpacks, push and guide a 114 kg asteroid toward a processing dock, exerting the forces, with F1 = 32 N, F2 = 52 N, F3 = 39 N, θ1 = 30°, and θ3 = 60°. What is the (a) magnitude and (b) angle (measured relative ..

Multiple regression model and independent variables : Propose a business problem that would be best solved by multiple regression analysis. How would you evaluate the quality of the multiple regression model?

Case for and against drug testing : Case For and Against Drug Testing - Is this a good thing or is this something that violates the 14th amendment?

Identify position-indicate what pattern is found in thread : Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

Experiences of lower back pain : A 36 year old female has a 75 degree ROM in her hamstring and experiences lower back pain. How does this affect her movement? Design a program to help her reduce her lower back pain.

Calculate the bond price : Consider an America Off Line thirty year, semiannual bond. It is issued at par today. Interest rates remain at 6 percent for five years, and then GRADUALLY, over 5 years rises to 7%,

Campus food service case study : Provide examples that support why this student should not intentionally lie about these safety and health issues that were clearly violated.

At what value of z does e have its maximum value : What is the frequency of the small axial oscillations that the electron will undergo if it is free along the z-axis near the origin.

User Account

All Pages