What is the speed of lander just before it touches surface

Assignment Help Physics
Reference no: EM1361877

Q. Three astronauts, propelled by jet backpacks, push and guide a 114 kg asteroid toward a processing dock, exerting the forces, with F1 = 32 N, F2 = 52 N, F3 = 39 N, θ1 = 30°, and θ3 = 60°. What is the (a) magnitude and (b) angle (measured relative to the positive direction of the x axis) of the asteroid's acceleration?

Q. A lunar lander is making its descent to Moon Base I. The lander descends slowly under the retro-thrust of its descent engine. The engine is cut off when the lander is 5.0 m above the surface and has a downward speed of 0.8 m/s. With the engine off, the lander is in free fall.

What is the speed of the lander just before it touches the surface?

The acceleration due to gravity on the moon is 1.6 m/s^2.

Reference no: EM1361877

Questions Cloud

Explain samsung electronic attempt to make profits : Explain Samsung Electronic attempt to make profits from rising consumer demand after the crash. Analyze how both companies attempted to make a profit after the crash
Making an investment with a return : Your firm's weighted average cost of capital is 11 percent. You believe the company should make a particular investment, but the IRR of this investment is only 9 percent.
Capital management practice analysis - automobile industry : Get a list of best practices for talent acquisition and the top five best human capital management practices within the automobile industry.
Body fat and diet program : A 5'9", 140lb 32 year old female has a body fat percentage of 32% when measured using the BodPod. How accurate is her assessment? Where does she stand? Design a one week diet program to help her reach her goals.
What is the speed of lander just before it touches surface : Three astronauts, propelled by jet backpacks, push and guide a 114 kg asteroid toward a processing dock, exerting the forces, with F1 = 32 N, F2 = 52 N, F3 = 39 N, θ1 = 30°, and θ3 = 60°. What is the (a) magnitude and (b) angle (measured relative ..
Multiple regression model and independent variables : Propose a business problem that would be best solved by multiple regression analysis. How would you evaluate the quality of the multiple regression model?
Case for and against drug testing : Case For and Against Drug Testing - Is this a good thing or is this something that violates the 14th amendment?
Identify position-indicate what pattern is found in thread : Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.
Experiences of lower back pain : A 36 year old female has a 75 degree ROM in her hamstring and experiences lower back pain. How does this affect her movement? Design a program to help her reduce her lower back pain.

Reviews

Write a Review

Physics Questions & Answers

  Estimate the velocity of third piece that explodes at rest

An object at rest explodes into three pieces of equal masses. One moves east at 23 m/s,  while the second piece moves northwest at 14 m/s. Estimate the velocity of the third piece? Suppose each piece has a mass of 2 kg.

  What is the x component of the vector

A ball is thrown directly up from the ground with speed vsub0. At the same time, a second ball is dropped from rest from a height H, straight above the point where the first ball was thrown upward. There is no air resistance. A) Find out the time at ..

  What is the lumberjack''s speed relative to shore

An astronaut on a small planet wishes to measure the local value of g by timing pulses travelling down a wire which has a large object suspended from it. Imagine the wire of mass 3.80 g is 1.60 m long and has a 3.00-kg object suspended from it. A pul..

  How to calculate the ground state energy

A particle of mass m is constrained to move between two concentric impermeable spheres of radii r = a and r = b (a

  How large is the horizontal component of the force

A vertical scale on a spring balance reads from 0 to 245 rm{N}. The scale has the length of 11.0 rm{cm} from the 0 to 245 rm{N} reading. A fish hanging from bottom of the spring oscillates vertically at a frequency of 3.00 rm{Hz}.Ignoring the mass..

  What is the linear speed of the fishing line

what is the linear speed of the fishing line. The force exerted by the wind on the sails of a sailboat is 300 N north. The water exerts a force of 150 N east. If the boat (including its crew) has a mass of 300 kg, what are the magnitude and directi..

  What is the equivalent spring constant k of bone

A man of mass 65 kg falls stiff-legged straight down from a height of 2m. He lands on one foot. The femur is a bone in the leg with the length L=.65m, and a cross-sectional area of about 2.0 x 10^-4m^2. The Young's modulus for bone is 9.4x 10^9 N/..

  Discuss any interaction between the proton and electron

A pair of oppositely charged parallel plates are separated by a distance of 5 cm with a potential difference of 550 V between the plates. A proton is released from rest at the positive plate at the equal time that an electron is released from rest..

  Find the angle that rod makes with the horizontal

A uniform 1.3 kg rod that is 0.8 m long is suspended at rest from ceiling by two springs, one at each end of the rod. Both springs hang straight down from the ceiling.

  Explain in terms of newton laws of motion

find the maximum distance she can be from the craft and still return within 2.30 min (the amount of time the air in her helmet remains breathable).

  What is the size of the induced current in the loop

A 10 μF capacitor is charged to 15 V. It is next connected in series with an uncharged 5.00-μF capacitor. The series combination is finally connected across a 50.0-V battery, as diagrammed. Find out the new potential differences across the 5-μF an..

  Find out the acceleration of the sled and child

Find out the acceleration of the sled and child

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd