Zoonoses disease-transmissible spongif orm encephalopathies, Biology

Assignment Help:

Transmissible spongif orm encephalopathies


Transmissible spongiform encephalopathies (TSEs, also called Prion diseases) are fatal neurodegenerative diseases such as scrapie of sheep, Creutzfeldt-Jakob disease (CJD) of humans, bovine spongiform encephalopathy (mad cow disease) and chronic wasting disease (CWD) of deer and elk. Bovine Spongiform Encephalopathy is thought to be the cause of variant Creutzfeldt Jakob Disease (vCJD) which is a neurological disease different from CJD, leading to death in humans. TSEs are caused by accumulation of prion protein, an abnormal form of protein found in humans and animals. Normal prion protein is expressed in a wide variety of tissues, but conversion of normal prion protein to the TSE form appears to be restricted primarily to cells of the nervous and lymphoid systems. In order to determine why some cell types are more resistant to TSE infection than others, scientists developed a tissue culture system that allows them to monitor both acute and persistent abnormal prion protein (PrP- res) formation. It has been demonstrated that while any cell type can make new PrP- res following exposure to TSE infectivity, only some cell types go on to become chronically infected and make PrP-res persistently. This suggests that there are cell- specific factors that determine the susceptibility of a cell to chronic TSE infection. These factors, once identified, could be useful in designing effective anti-TSE therapeutics.


Related Discussions:- Zoonoses disease-transmissible spongif orm encephalopathies

General examination - heart failure, The patient will appear anxious and dy...

The patient will appear anxious and dyspnoeic. Patients in chronic heart failure are usually malnourished and even cachectic. Chronic passive venous congestion may produce exophtha

In how many form glycogen synthase exists, Glycogen  synthase exists  in t...

Glycogen  synthase exists  in two forms:   the phosphorylated form designated  as  'D' form is the  inactive one and  the dephoshorylated form designated as  'I'  form is the activ

Determine the nutritious meals to the elderly, Determine the nutritious mea...

Determine the nutritious meals to the elderly? The various considerations to be kept in mind for providing nutritious meals to the  elderly are highlighted herewith. Due

Explain anterior pituitary gland secretes hormones, Explain anterior pituit...

Explain anterior pituitary gland secretes hormones The anterior pituitary gland secretes hormones that elevate  the blood glucose and therefore antagonize the action of glucose

What is pancreas , What is Pancreas ? The pancreas lies in the abdomina...

What is Pancreas ? The pancreas lies in the abdominal cavity in a loop between the stomach and small intestine. The pancreas consists of two major types of cells: those produci

Glucose rehydration therapy, The movement  of Na + and glucose  from the l...

The movement  of Na + and glucose  from the lumen  of the intestine  across  the epithelial  cell to the blood  sets up a dissimilarity  in osmotic  pressure  across  the cell. As

Sea Lampreys, #questiHow do the non parasitic lampreys interact with other ...

#questiHow do the non parasitic lampreys interact with other members of their ecosystem in comparison to their parasitic cousinson..

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What can be deduced about the genotype, In pet rabbits, brown coat colour i...

In pet rabbits, brown coat colour is recessive to black coat colour. A black female rabbit gives birth to four black-coated and three brown-coated baby rabbits. What can be deduced

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd