Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Transmissible spongif orm encephalopathies
Transmissible spongiform encephalopathies (TSEs, also called Prion diseases) are fatal neurodegenerative diseases such as scrapie of sheep, Creutzfeldt-Jakob disease (CJD) of humans, bovine spongiform encephalopathy (mad cow disease) and chronic wasting disease (CWD) of deer and elk. Bovine Spongiform Encephalopathy is thought to be the cause of variant Creutzfeldt Jakob Disease (vCJD) which is a neurological disease different from CJD, leading to death in humans. TSEs are caused by accumulation of prion protein, an abnormal form of protein found in humans and animals. Normal prion protein is expressed in a wide variety of tissues, but conversion of normal prion protein to the TSE form appears to be restricted primarily to cells of the nervous and lymphoid systems. In order to determine why some cell types are more resistant to TSE infection than others, scientists developed a tissue culture system that allows them to monitor both acute and persistent abnormal prion protein (PrP- res) formation. It has been demonstrated that while any cell type can make new PrP- res following exposure to TSE infectivity, only some cell types go on to become chronically infected and make PrP-res persistently. This suggests that there are cell- specific factors that determine the susceptibility of a cell to chronic TSE infection. These factors, once identified, could be useful in designing effective anti-TSE therapeutics.
The patient will appear anxious and dyspnoeic. Patients in chronic heart failure are usually malnourished and even cachectic. Chronic passive venous congestion may produce exophtha
Glycogen synthase exists in two forms: the phosphorylated form designated as 'D' form is the inactive one and the dephoshorylated form designated as 'I' form is the activ
Determine the nutritious meals to the elderly? The various considerations to be kept in mind for providing nutritious meals to the elderly are highlighted herewith. Due
Explain anterior pituitary gland secretes hormones The anterior pituitary gland secretes hormones that elevate the blood glucose and therefore antagonize the action of glucose
what is fluid mosaic model
What is Pancreas ? The pancreas lies in the abdominal cavity in a loop between the stomach and small intestine. The pancreas consists of two major types of cells: those produci
The movement of Na + and glucose from the lumen of the intestine across the epithelial cell to the blood sets up a dissimilarity in osmotic pressure across the cell. As
#questiHow do the non parasitic lampreys interact with other members of their ecosystem in comparison to their parasitic cousinson..
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In pet rabbits, brown coat colour is recessive to black coat colour. A black female rabbit gives birth to four black-coated and three brown-coated baby rabbits. What can be deduced
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd